View of Phenotypic and Genotypic Detection of Biofilm Producing Methicillin Resistant Staphylococcus aureus (MRSA) Isolated from Human

(1)

19047 http://annalsofrscb.ro

Phenotypic and Genotypic Detection of Biofilm Producing Methicillin Resistant Staphylococcus aureus (MRSA) Isolated from

Human

Mustafa Naser Gatta1*, Mawlood Abbas Ali Al-Graibawi2

Zoonotic Disease Unit, 2* Department of Internal and Preventive Veterinary 1 Medicine/College of Veterinary Medicine, University of Baghdad, Iraq

Email: [email protected], 2*graibawi- [email protected]

*Corresponding author Abstract

This study was aimed for phenotypic and genotypic detection of biofilm-producing Methicillin-resistant Staphylococcus aureus (MRSA) isolated from human. One hundred and fifty human nasal samples from different locations in Baghdad governorate, Iraq were collected during the period from October 2020 to April 2021.

Samples were inoculated on mannitol salt agar (MSA) and incubated at 37°C for 24 hrs then, subcultured on blood agar. Detection of isolates was carried out according to colony characterization, Gram staining, conventional biochemical tests and analysis profile Vitek® 2, Bacterial resistance and MRSA was determined by disc diffusion.

The biofilm synthesis was detected by Congo red agar method. The genotypic analysis of MRSA isolates using deoxyribonucleic acid (DNA) extraction to detect the 23srRNA, and mecA genes by polymerase chain reaction (PCR) assay. The MRSA was found in 18.6% (28/150) of human swabs, the biofilm positive MRSA of 28 of human isolates were 89.28%.The isolates showed high rate of multidrug resistance 82.14%, with high resistance to penicillin and methicillin (100%), azithromycin (85.71%), fusidic acid (75%) and oxacillin (71.42%). However, it was sensitive to: Bacitracin (100%), Norfloxacin (96.42%), Gentamycin and Clindamycin (85.71%), Vancomycin (71.42%). Genotypes identified by PCR showed that all isolate (100%) harboring 23srRNA and 76% harboring mecA genes. Our results revealed a correlation of mecA gene and biofilm synthesis in MRSA isolate.

Keywords: Staphylococcus aureus, 23srRNA, mecA gene, biofilm, Methicillin, Oxacillin

Introduction

Staphylococci are Gram and catalase positive, aerobic, non-motile, non-spore forming, cocci, arranged as pairs, tetrads or oftentimes irregular grape like clusters, Staphylococcus (S.) aureus is the major important human and animals' pathogen among the staphylococci and involved in the producing of a numerous clinical cases

(2)

(Markey et al., 2014). It has the capability to fastly develop antibacterial resistance practically to antibiotic used to treat of clinical cases, which lead to the emergence of MRSA (Rahmaniar et al., 2020), it is one of the major human pathogens; it is responsible for various diseases such as skin infections, invasive infections including pneumonia, infections of soft tissues, bones, and even fatal septicemia in human (Gordon and Lowy, 2008). MRSA are resistant to β-lactam antibiotics and mostly showed multidrug-resistant (MDR) to other antimicrobial agents, e.g., tetracycline, macrolides, aminoglycosides, and fluoroquinolones that are commonly used in the treatment of disease caused by these microorganisms (Ness, 2010). Biofilm synthesis by bacteria significantly participate in their survival in the host and has been considered as a key virulence factor responsible for serious chronic infections (Parrino, et al., 2019), the ability to produce biofilms is very important for S. aureus pathogenicity (Suresh, et al., 2019) and play a vital roles in its resistance aganist antimicrobial therapy and innate host defense mechanisms (Otto, 2008; Parrino, et al, 2018). Additionally, biofilm production by S. aureus and resistant to antimicrobial are functionally associated, as the phenotype of biofilm expression can be influenced by the occurrence of antimicrobial resistance (Stewart, 2002 and McCarthy, et. al., 2015). Numerous food- borne infections are associated with biofilms synthesis and regarded as an emergent public health concern (Srey, et. al., 2013) Biofilm-mediated disease have an adverse effect on the health of patient, and therefore the aim of this study was to phenotypic and genotypic detection of biofilm-producing MRSA isolated from human.

MaterialsandMethods

Sampling, isolation and identification of MRSA

This study was approved by The Committee of Ethics Research of the zoonotic unit, College of Veterinary Medicine, University of Baghdad, Ministry of High Education and Scientific Research-Iraq (No. 1177/ 23-9-2020). One hundred and fifty human nasal samples were collected from different locations in Baghdad governorate, Iraq during the period from October 2020 to April 2021. Samples were streaked on the surface of blood agar and MSA and incubated at 37°C for 24 hrs, identification of the isolates was carried out according to colony characterization, grape like clusters by Gram staining, conventional biochemical analysis including haemolysis, catalase, coagulase, oxidase, DNase and mannitol fermentation tests (Marky et al., 2014).In addition, to analysis profile Vitek® 2 compact system (BioMérieux, France).

Antimicrobial susceptibility testing

Bacterial resistance was determined by disc diffusion as previously reported (Bauer et al, 1966) against antimicrobial discs that are commonly used for treatment of human, the inhibitory zones around these discs were measured by millimeter (mm) unit by using a metric ruler, which showed that the isolate was interpreted as susceptible, intermediate, or resistant to particular antibiotic (CLSI, 2020). Phenotypic detection

(3)

of MRSA strains was performed by the disc diffusion assay, the genotypic confirmation of MRSA was performed to detect 23srRNAandmecA gene by PCR.

Biofilm detection assay

Biofilm synthesis of isolates were detected by Congo red agar (CRA) method as described by Freeman et al., (1989). Briefly, MRSA isolates were streaked on CRA, this medium was prepared by dissolving brain heart infusion broth (BHI) 37.9 g, sucrose 50g, Agar-Agar 10g and 0.8g Congo red powder. The BHI, sucrose, Agar Agar was dissolved in 990 ml of distal water in flask, then heating at 100 C. The 0.8g of Congo red stain was dissolved in 10 ml distal water in other flask and sterilize the two flasks by autoclave then the Congo red solution was added to other components after cooling 50 C, mixed all and poured in plates.

Molecular of identification for isolates MRSA

For PCR, genomic S. aureusDNA was extracted by Kit (Geneaid, Thailand).

Concentrations and purity of extracted DNA was determined by Nanodrop spectrophotometer(Thermo, USA).Gel electrophoresis was used to detect DNA bands stained with red safe dye and visualized under UV light as described by Sambrook and Russell (2001). For DNA extraction1g agarosewas used. To generate PCR products 2g agarose was added to 100 ml 1XTBE buffer, boiled and cooledto 50°C For polymerization, 2μl of Red Safe dye was poured and left 30 min at room temperature(Tsaiet al,.2017). Gels poured intochambersthen covered with 1 X TBE buffer.Then 10 μl samples were mixed with 5 μl dye buffer and loaded into wells with gel. DNA products were screened for the presence of 23sr RNA andmecA genes by PCR(Table 1), with specific primers(Bioneer, Korea) and PCR mixture of 20 µl with 2 µl premix ofTaq DNA polymerase, MgCl2, dNTPs, KCl, stabilizer tracking dye and tris-HCl, 1 µl of each primer (final concentration was 10 picomole /µl) and 2 µl of DNA template then the volume was completed with sterile distilled water (Long,et al,. 2018).

primer selection

tow primers were used in this study were mecAand 23srRNAprimers to detect the MRSA

Table 1. Types of primers were used in PCR assay and their designer

Code 5-3 Product length

MecA-F GCCCGTGGATTTAGTCGTTGA 623 bp

MecA-R CGTCGAACTTGAGCTGTTACG

23 srRNA-F TCGGAATCTGGGAGGACCAT 350 bp

23 srRNA-R AACGTAAGTCGGTTCGGTCC

These primers that used (from Alpha DNA company, Canada) which were provide as

(4)

lyophilized form and were dissolved in sterile deionize D.W to gave a final concentration 100 Pico mole /μl according to the recommendation of provider and then store in a deep freezer until use.

Amplification reaction

Table 2. Conditions of polymerase chain reactions

Before electrophoresis, PCR products for each well were loaded with 5 µl sample.

DNA ladders 100bp and 1kb (KAPA Biosystem/USA) were run concurrently with each electrophoretic run to detect size of amplified PCR product. Electrophoresis was performed at 70V for 1.5 hour for extracting genomic DNA and PCR products, then DNA bands visualized by UV trans illuminator (Scope-21/Japan)^[15]and photographed by using a digital camera.

Results

We found S. aureusin 18.6% (28/150) human samples. Suspected colonies of S.

aureus isolates appeared on mannitol salt agar as round, smooth, and fermenting or non-fermenting mannitol red-yellow as shown in Figures 1 and 2, below.

Figure 1-Fermentation of mannitolby Staphylococcus aureuson Mannitol Salt Agar.

Final Extension

Extension Annealing Denaturation No. of cycles

Initial denaturation

Gene cycle 72

second 45

cycle 72 second 45

cycle 58 second 45

cycle 94 second 45

35 94 cycle

7min

MecA

cycle 72 second 45

cycle 58 second 45

cycle 94 second 45

35 94 cycle

7min

23srRNA

(5)

Figure 2. Mannitol fermenting and non-fermenting Staphylococci on salt media

S. aureusappeared as Gram positive, cocci, single cell pairs and grape-like clusters.

The isolates were positive for catalase, gelatinase and DNase (Figure 3), coagulase tests (Figure 4), and hemolysis (Table 3).

Fig 3- Staphylococcus aureusDNAse test

Fig 4 -Staphylococcus aureusgelatinase test

Table 3: Biochemical reactions forStaphylococcus aureus.

Catalase +

Oxidase -

DNAse +

Coagulase +

Gelatin liquefaction +

Hemolysis +

(6)

Table 4: Percentage of resistant and susceptible isolates of S.aureus in human

Antibiotic (mg) Total sampls

Sensitive Intermediat e

Resistant

Methicillin(5)mcg 28 0(%) 0(0%) 28(100 %)

Oxacillin(1)μg 28 6(21.42 %) 2(7.14%) 20(71.42%) Azithromycin(15)mcg 28 4(14.28%) 0(%) 24(85.71%) Vancomycin(30)mg 28 20(71.42%) 1(3.57%) 7(25%)

Fusidic acid(30)μg 28 7(25%) 0(%) 21(75%)

Gentamicin(10)μg 28 24(85.71%) 0(0%) 5(17.85%) Clindamycin(10)μg 28 24(85.71%) 0(%) 4(14.28%)

Bactricin(10)IU 28 28(100%) 0(%) 0(%)

Benzylpencilin(10)IU 28 0(%) 0(%) 28(100%)

Norfloxacin(10)μg 28 27(96.42%) 0(%) 1 (3.57%) Polymyxin pb300unit 28 16(57.14%) 0(%) 12(42.85%)

The biofilm positive MRSA of human swabs were 89.28%, the association of biofilm formation with mecA gene were 76.0%.

Fig 5.S.aureuspositive to Congo red test change the color to black colony.

Fig 6: Genomic DNA bands of S aureus in human isolates by gel electrophoresis (1 % agarose, 90V, for 1.5 hour)

(7)

Fig 7.PCR product analysis of 23srRNA gene (350pb) in S. aureus isolates on agarose gel electrophoresis. where the marker (2000 -100bp) all the (28) positve isolates from human samples at PCR product.

Fig 8.PCR product analysis of mecA gene (632pb) in S. aureus isolates onagarose gel electrophoresis.where M:marker(2000 -100bp)18 positive isolates from human samples at PCR product.

Discussion

The colony characterization, Gram staining and conventional biochemical tests in the current are similar to phenotypic characters for S. aureus as reported by Markey, et.

al., (2014). In the current study, MRSA was found in 18.6% (28/150) nasal human samples, which is lower than that reported by Mohanty et al. (2018) who mentioned the percentage of 29.4% from nasal swabs in Egypt and less than the isolation rate of 69.5% reported by Alebachew et al. (2012) in Ethiopia. Yaseen et al. (2013) reported that the isolation rate 41% of S. aureus from patients with wound and burn infections in Al-Jumhuory Teaching Hospital in Mousl, Iraq.

Numerous techniques were developed for detection of MRSA including phenotypic (disk diffusion test) and genotypic methods such as, the mecA and blaZ genes, which are considered a genetic marker used for the rapid and direct detection of MRSA (Ostojić, et. al, 2015). Of the 28 MRSA isolated from human nasal swabs 25

(8)

(89.28%) were biofilm positive isolates. The growth of our isolates on Congo red agar showed its ability to form a slime layer; similar result was reported previously (Achek, et.al., 2020), the Congo red agar was used in the detection of the slime (biofilm) production from S. aureus isolated from human and animals (Horiuk, et. al., 2019). Early identification of biofilm forming S. aureus in clinical isolates could be an important method in control and prevention of the infections (Horiuk, et. al., 2019).

Monitoring the development of biofilm positive and multidrug resistant MRSA in human and animals are essential to prevent or control the spreading of this pathogen and the related zoonotic hazard.

In the present study, the antimicrobial susceptibility test of S. aureus isolated from human revealed high rate of multidrug resistance 82.14%, with high resistance to penicillin and methicillin (100%), azithromycin (85.71%), fusidic acid (75%) and oxacillin (71.42%). Several studies have shown that the S. aureus are resistant to one or more antimicrobial agent (Dweba et al., 2018; Akanbi et al., 2017). Alebachew et al., )2012) and Elhassan et al., (2015) reported that S. aureus isolated from burn wound and different clinical specimens was 77.3% and 100% resistant to methicillin respectively, while Spanu et al., )2012) and Rahman et al., )2018) recorded the that 90% and 100% of S. aureus recorded from pus, wound infection was resist to oxacillin respectively, and Tigabu et al., )2018) mentioned that isolated from school children in Etheopia was 100% resistant to Cefoxitin. In Iraq, Lafi, (2019). Noticed that the human S. aureus isolates showed resistance (85.7) to methicillin, (80.9%)toOxacillin, (78.5%)to Cefoxitin, (52.3%)to Gentamycin, (47.6%)to Vancomycin, (42.8%) to Clindamycin(35.7%) to Chloramphenicol, (33.3%) to Trimethoprim. The incorrect usage of antimicrobial agents poses great hazards to both animal and human health due to the emergence of antimicrobial resistance (Okocha et al., 2018). The differentiation between antimicrobial susceptibility patterns among MRSA isolates may be back to the geographical location, and drugs approved, or back to multiple antimicrobial uses of MRSA treats which lead to microbial adaptation to these antibiotics, or (Li and Webster, 2018).

Genotypes identified of the 28 MRSA isolated from human by PCR showed that all isolate (100%) harboring 23srRNA and 76% harboring mecA genes. which is higher than that has been observed in Iran by where the rate was 56%% from patient’s(Ghasemiam and Mirzaee, 2016).and lower than result reported by, AL- Ruaily and Khalil, (2011) they mentioned the rate of mecA 86.7% isolated from urine of patients in Bangladesh. The mecA-negative MRSA isolated in the current study;

might be due to the presence of mecA homologues as mec C or other ß lactam resistance mechanisms, such as blaZ gene (Elsayed et al., 2015; El-Ashker et al., 2015).

(9)

Refrance

1. Stewart, P.S. (2002). Mechanisms of antibiotic resistance in bacterial biofilms. Int. J. Med. Microbiol. 292, 107–113.

2. Parrino, B.; Schillaci, D.; Carnevale, I.; Giovannetti, E.; Diana, P.;

Cirrincione, G.; Cascioferro, S. (2019). Synthetic small molecules as anti- biofilm agents in the struggle against antibiotic resistance. Eur. J. Med. Chem.

161, 154–178.

3. Parrino, B.; Diana, P.; Cirrincione, G.; Cascioferro, S. (2018). Bacterial biofilm inhibition in the development of effective anti-virulence strategy.

Open Med. Chem. J. 12, 84–87 .

4. Suresh, M.K.; Biswas, R.; Biswas, L.(2019). An update on recent developments in the prevention and treatment of Staphylococcus aureus biofilms. Int. J. Med. Microbiol. 309, 1–12.

5. Otto, M. (2008). Staphylococcal biofilms. In Current Topics in Microbiology and Immunology; Springer: Berlin/Heidelberg, Germany; Volume 322, pp.

207–228.

6. McCarthy, H.; Rudkin, J.K.; Black, N.S.; Gallagher, L.; O’Neill, E.;

O’Gara, J.P. (2015). Methicillin resistance and the biofilm phenotype in Staphylococcus aureus. Front. Cell. Infect. Microbiol. 5, 1.

7. Srey, S.; Jahid, I.K.; Ha, S.-D.(2013). Biofilm formation in food industries:

A food safety concern. Food Control, 31, 572–585..

8. Gordon, R. J. and Lowy, F. D. (2008). Pathogenesis of methicillin-resistant Staphylococcus aureusinfection. Clinical infectious diseases, 46 (Supplement_5), S350-S359.

9. Freeman, D. J., Falkiner, F. R. and Keane, C. T. (1989). New method for detecting slime production by coagulase negative staphylococci. J ClinPathol.

42:872-4.

10. Markey, B.K.; Leonard, F.C.; Archambault, M. Cullinane, A. and Maguire, D. (2014). Clinical Veterinary Microbiology. 2nded. Mosby Elsevier. Pp.161.

11. Bauer, A.W,. Kirby, W.M.M,.Sherris, J.C,.Turck, M. (1966).

AntibioticSusceptibility testing by a standard single disc diffusion method.

Am.

12. J Clin. Pathol. 45:493-496.

(10)

13. Sambrook and Russell (2001).Molecular Cloning: A Laboratory Manual (3rd ed.). Cold Spring Harbor Laboratory Press. ISBN 978-0-87969-577-4.

14. Tsai, S.Y, Chang FC, Ma KSK, et al. (2017). Systemic Analysis of the mecA Gene Using a Bioinformatics Tool. Open Forum Infect Dis;4(Suppl 1):S644. Published Oct

15. Matono, T.;Nagashima, M.;Mezaki, K.;Motohashi,A,.;Kutsuna, .;

Hayakawa, K.; Ohmagari, N. Kaku, M. (2018). Molecular epidemiology of β-lactamase production in penicillin-susceptible Staphylococcus aureus under high-susceptibility conditions.

16. J Infect Chemother. 24(2):153–5.

17. Long, K.S, Munck, C,. Andersen, T.M, Schaub, M.A, Hobbie SN, Bottger EC, Vester B (2010).Mutations in 23S rRNA at the PeptidylTransferase Center and Their Relationship to Linezolid Binding and Cross-Resistance.

Antimicrobial Agents and Chemotherapy. 54 (11): 4705–4713.

18. Ostojić, M. and Hukić, M. (2015). Genotypic and phenotypic characteristics of Methicillin-resistant Staphylococcus aureus (MRSA) strains isolated on three different geography locations. Bosnian journal of basic medical sciences, 15(3), 48.

19. Horiuk, Y.V.; Kukhtyn, M.D.; Salata, V.Z. and Horiuk, V.V. (2020). Species composition and methicillin resistance of staphylococcus taken on dairy farm.

Veterinary Sciences, 22 (97), 13-19.

- Achek, R.; Hotzel, H.; Nabi, I.; Kechida, S.; Mami, D.; Didouh, N.;

Tomaso, H.; Neubauer, H.; Ehricht, R.; Monecke, S.; et al.(2020).

Phenotypic and molecular detection of biofilm formation in Staphylococcus aureus isolated from different sources in Algeria.

Pathogens 2020, 9, 153.

20. Horiuk, Yu.,Kukhtyn, M., Kovalenko, V., Kornienko, L., Horiuk, V.,

&Liniichuk, N. (2019). Biofilm formation in bovine mastitis pathogens and the effect on them of antimicrobial drugs. Independent Journal of Man- agement& Production, 10(7), 897–910.

21. Markey, B.K.; Leonard, F.C.; Archambault, M. Cullinane, A. and Maguire, D. (2014). Clinical Veterinary Microbiology. 2nded. Mosby Elsevier. Pp. 105- 120.

22. Mohanty, A.; Mohapatra, K. and Pal, B. (2018). Isolation and Identification of Staphylococcus aureusfrom Skin and Soft Tissue Infection in Sepsis Cases, Odisha. J Pure ApplMicrobiol, 12, 419-424.

23. Alebachew, T.; Yismaw, G.; Derabe, A. and Sisay, Z. (2012). Staphylococcus aureusburn wound infection among patients attending Yekatit 12 hospital burn unit, Addis Ababa, Ethiopia. Ethiopian journal of health sciences, 22(3).

(11)

24. Yaseen, I.H.; Shareef, A.Y., and Daoud, A.S. (2013). High prevalence of multidrug-resistance MRSA and VRSA of different infections from Al-Jumhuory teaching hospital patients in Mosul. Journal of Life Sciences [Internet], 1255-9.

25. Dweba, C.C.; Zishiri, O.T. and El Zowalaty, M.E. (2018). Methicillin-resistant Staphylococcus aureus: Livestock-associated, antimicrobial, and heavy metal resistance. Infection and drug resistance, 11, 2497.

26. Akanbi, O.E.; Njom, H.A.; Fri, J.; Otigbu, A.C. and Clarke, A.M. (2017).

Antimicrobial susceptibility of Staphylococcus aureusisolated from recreational waters and beach sand in eastern Cape Province of South Africa. International Journal of Environmental Research and Public Health, 14(9), 1001.

27. Elhassan, M.M.; Ozbak, H.A.; Hemeg, H.A.; Elmekki, M.A. and Ahmed, L.M. (2015). Absence of the mecA gene in methicillin resistant Staphylococcus aureusisolated from different clinical specimens in shendi city, Sudan. BioMed research international, 2015.

28. Spanu, V.; Spanu, C.; Virids, S.; Cossu, F.; Scarano, C. and De Santis ,E.

(2012). Virulence factors and genetic variability of Staphylococcus aureusstrains isolated from raw sheep’s milk cheese. International Journal of Food Microbiology; 34:587–590.

29. Rahman, M.M.; Amin, K. B.; Rahman, S.M.M.; Khair, A.; Rahman, M.;

Hossain, A. and Alam, M. M. (2018). Investigation of methicillin-resistant Staphylococcus aureusamong clinical isolates from humans and animals by culture methods and multiplex PCR. BMC veterinary research, 14(1), 300.

30. Tigabu, A.;Tiruneh, M. and Mekonnen, F. (2018). Nasal carriage rate, antimicrobial susceptibility pattern, and associated factors of Staphylococcus aureuswith special emphasis on MRSA among urban and rural elementary school children in Gondar, Northwest Ethiopia: A comparative cross-sectional study.

Advances in preventive medicine, 2018.

31. Lafi, Z.K. (2019). Determination of antimicrobial resistance blaZ and mecA genes and immunotherapeutic efficacy of transfer factor to staphylococcus aureusisolated from human and buffalo.MS.C thesis. College of Veterinary Medicine- Unversity of Baghdad.

32. Okocha, R.C.; Olatoye, I.O. and Adedeji, O.B. (2018). Food safety impacts of antimicrobial use and their residues in aquaculture. Public health reviews, 39(1), 1-22.

33. Li, B. and Webster, T.J. (2018). Bacteria Antibiotic Resistance: New Challenges and Opportunities for Implant-Associated Orthopedic Infections.

Journal of Orthopaedic Research: Official Publication of the Orthopaedic Research Society, 36, 22-32.

34. Ghasemiam A. and Mirzaee M. (2016). Methicillin Resistant Staphylococcus aureus(MRSA) Strains and the Staphylococcal Cassette Chromosome mec Types in Iran. Infect Epidemiol Med 2016; 2(3): 31-4.

(12)

35. Al-Ruaily, M.A. and O.M. Khalil, (2011).Detection of (mecA) gene in Methicillin Resistant Staphylococcus aureus (MRSA) at Prince A/RhmanSidery Hospital, Al-Jouf, Saudi Arabia. J. Med. Genet. Genom., 3:

41-45.

36. Elsayed, M.S.; El-Bagoury, A.E. M.; and Dawoud, M.A. (2015). Phenotypic and genotypic detection of virulence factors of Staphylococcus aureusisolated from clinical and subclinical mastitis in cattle and water buffaloes from different farms of Sadat City in Egypt. Veterinary world, 8(9), 1051.

37. El-Ashker, M.; Gwida, M.; Tomaso, H.; Monecke, S., Ehricht, R.; El- Gohary, F. and Hotzel, H. (2015). Staphylococci in cattle and buffaloes with mastitis in Dakahlia Governorate, Egypt. Journal of dairy science, 98(11), 7450- 7459.

38. Ness T. (2010).Multiresistant bacteria in ophthalmology. Ophthalmologe.

07(4):318–22.