Phenotypic and Genotypic Detection Ampc β-Lactmase Producing E.coli Isolated from UTI in Anbar Governate
Yusser Mahmoud Ragheb
1, Ali Hazim Abdulkarim
21Department of Biotechnology , College of Science , University of Anbar , Anbar , Iraq.
2Department of Biology , College of Science , University of Anbar , Anbar , Iraq.
*Corresponding author. E mail: [email protected].
Abstract :
The plasmid facilitates the transfer of the AmpC enzyme gene to other bacteria through conjugation and transformation . Urine samples of 130 patients were collected i from both genders and i different ages of patients i with suspected urinary tract infections according to theclinical manifestations and symptoms diagnosed by the examining physician in Alramadi teaching hospital and pediatric hospital , during the period from October 2019 to February 2020 . The antibiotic susceptibility results for 9 antibiotics showed that the a highest resistance isolates to Ceftazidime (100%), Ampicilin(92%), Ceftriaxone(86%) , Trimethoprim/ Sulfamethoxazole (86%) , Cefepime(70%) ciprofloxacin (62%), Gentamicin(46%) , Cefoxitin ( 14%) and Nitrofurantoin ( 8%).
Phenotypic detection for AmpC productin show that in CC-DDS test appeared 17 positive isolates , in(mCIM) method all isolate gave positive result ,EDTA use to differentiate Metallo-β-lactamase from serine cephalosporinase ,EDTA use as inhibitor of Metallo-β-lactamase ,while Modified Hodge test showed 14 isolate were positive result. The polymerase chain reaction results of twenty-three isolates showed the highest prevalence for blaFOX gene was detected in 13 isolate (56.5%), blaACC gene was detected in 12 isolate (52.1%) , bla DAH gen was detected in 12 isolate (52.1%),8 isolate (34.7% ) had blaCIT gene , bla EBC Where was identified in 6 isolate (26.08), while the lowest percentage for blaMOX gene was identified in 5 isolate (21.7%) .
Key words : AmpC , E. coli , FOX , MOX
Introduction
Escherichia coli is the most common type of pathogen that causes disease. Infection in the urinary tract (UTI), caused by E. Coli is the most serious infectious disease with substantially higher morbidity , mortality and health-care costs(Raeispour & Ranjbar,
2018). β-lactamase synthesis by gram-negative bacteria is considered to be the most important and crucial mechanism of resistance to β lactam drugs (Ahmed & Al Meani, 2019) .
The β lactamases are classified in four groups; classes A, C and D are serine-β- lactamases, while class B is β-lactamases metallo enzyme (Sah & Hemalatha, 2015) . β-lactamases were categorized by Ambler and Bush-Jacoby-Medeiros based on their function and molecular structure. (Al Meani et al., 2020). According to Ambler and Bush-Jacoby, Ampβ-lases belong to Class C and Group 1. These enzyme inhibitors do not function on oxyimino-cephalos and cefobactam, for example. Cloxacillin and borononic acid were used in phenotypical studies to validate the presence (Bush &
Bradford, 2020) .the global production of AmpC and the possibility of becoming a 'plasmid gene dispersion to other plasmids' is no longer a real one (M. O. Ibrahim &
Al Meani, 2020). This enzymes are typically coded by chromosomal genes in several gram negative bacterium. While the encoding genes of these enzymes were described in plasmids at the end of the 1980s, they could be passed between various species (Hoseini et al., 2017).Commonly reported genotypes of AmpC genes are blaMOX, blaCIT, blaDHA, blaFOX , blaACC and bla EBC.
This work aimed to determine the prevalence of (AmpC) β-lactamases genes in local clinical isolates of Escherichia coli , evaluate phenotypic methods for detection of this β-lactamase.
Materiales and Methods :
Sample Collection:
The specimens were collected from patients in Alramadi city from two hospital, during the period from October 2019 to February 2020, that is by taking midstream urine samples from the patients. And then it was transferred directly to laboratory for the purpose of its development and diagnosis, as it was cultured using the Streaking method on petri dishes containing MacoCongy agar media and EMB agar, and incubated at 37 ° C for 18-24 hours (MacFaddin, 2000).Identification of bacteria using conventional and automated vitek -2 system .
Antimicrobial susceptibility testing :
Antimicrobial susceptibility testing performed using conventional disk diffusion method. According to the guidelines recommended by the CLSI(2019) ; antibiotic resistance was determined by using antibiotic discs listed
:
Ampicilin , Gentamicin, Ceftriaxone Ceftazidimim ,Ciprofloxacin , trimethoprime-sulfamethoxazole , Nitrofurantoin , Cefepime , and Cefoxitin
.
Phenotypic detection of AmpC in E. coli :
Estimation of ESBls was carried out by modified Hodge test, synergy test, mCIM and CC-DDS under the CLSI guidelines (Clinical And Laboratory Standars Institute, 2018)and as described elsewhere (Poirel et al., 2011).
Genotypic detection of AmpC in E. coli :
10ml of nutrient broth was inoculated with over night bacterial culture and incubated at 37C°. Genomic DNA was extracted from the culture of bacterial isolates by using HiPurA® Bacterial Genomic DNA Purification Kit (HIMEDA) depending on the instruction of a manufacturing company. The DNA concentration of samples was estimated by using Nano drop Spectrophotometer, by putting 1 μl of the extracted DNA in the instrument to detect concentration in ng/μl, and purity detected by noticing the ratio of absorbance at wavelength 260/280 nm. All primers were supplied by company Bioneer (Korea) as lyophilized product Primer were dissolved with deionized water (ddH2O). Final concentration of (100 pM/μl) (as stock solution) was prepared table 1. To prepare 10 pM concentration as work primer, re-suspended 10 μl of stock solution in 90 μl of ddH2O to reach a final concentration 10 pM, mixed well and kept in -20 C. They were mixed by vortex to homogenize before use at table 2.
Table :(1 ) Sequences of PCR primers
Gene Primers'Sequences (5'→3') Product size (bp) DHA F:AACTTTCACAGGTGTGCTGGGT
R:CCGTACGCTTACTGGCTTTGC
405 bp
ACC R:AACAGCCTCAGCCGGTTA R:TTCGCCGCAATCCCTAGC
346bp
MOX F:GCTGCTCAAGGAGCACAGGAT R: CACATTGACATAGGTGTGC
520 bp
FOX F:AACATGGGGTATCAGGGAGATG R: CAAAGCGCGTAACCGGATTGG
190bp
CIT F:TGGCCAGAACTGACAGGCAAA R:TTTCTCCTGAACGTGGCTGGC
462 bp
EBC F:TCGGTAAAGCCGATGTTGCGG R: CTTCCACTGCGGCTGCCAGTT
302 bp
* F: Forward sequences, R: Reverse sequences.
Table (2): Program of PCR reaction:
Result and disscusion :
Isolation and identification of E. coli
All methods such as morphological , microscopic , biochemical test and automated test gave positive result for E. coli . table3
Table 3 : Phenotypic characteristics and biochemical tests results of the E.coli. ' + ' indicated positive result, ' - ' indicates negative result.
E coli
Characteristic
-
Gram Staining
bacilli
Shape
+
Catalase test
-
Oxidase test
+
Indol Test
+
Methyl Red Test
-
MR-VP Test
-
Citrate Utilization Test
+
Fermentation of Glucose
+
Fermentation of Lactose
-
H2S
-
Urease Kilgler A/A
+ gas
Antimicrobial susceptibility testing :
Fifty isolates of Ecoli from UTI patients were tested for antibiotic sensitivity by disk diffusion method according to the recommendation(Institute, 2019) as figure 1 . Antimicrobials including: Ampicilin, Gentamicin, Ceftriaxone , Ceftazidime , ciprofloxacin, Trimethoprim/ Sulfamethoxazole , Nitrofurantoin , Cefepime and Cefoxin. The present study shows a highest resistance to Ceftazidime (100%), Ampicilin(92%), Ceftriaxone(86%) , Trimethoprim/ Sulfamethoxazole (86%) , Cefepime(70%) ciprofloxacin (62%), Gentamicin(46%) , Cefoxitin ( 14%) and Nitrofurantoin ( 8%) figure (4-12) . In our study resistance to third generation it was as follows; ceftazidime was (100%) this agree with results of study conducted by Odongo (Odongo et al., 2020) on Patients with UTI at Mulago Hospital, Kampala, Uganda. Another study was conducted in Kashan, Iran It did not agree with the results of our study , where was the percentage of resistance 49.3% (Neamati et al., 2015) . While Ceftriaxone resistance was (86%) this result was approach to result from Patient in Zakho City/Iraq made by the researcher on Escherichia coli was the resistance is 87% (M. S. Ibrahim et al., 2020) .
Figure (1): Antimicrobial susceptibility test of Escherichia coli
Phenotypic detection of AmpC β-lactamases
InCC-DDS test appeared 17 positive isolates . In(mCIM) all isolate gave positive result. EDTA use to differentiate Metallo-β-lactamase from serine cephalosporinase ,EDTA use as inhibitor of Metallo-β-lactamase .The Modified Hodge test showed 14 isolate were positive result . Figure ( 2) , table 3
Table 3 : Phenotypic detection of AmpC β-lactamases
Figure (2): A) positive modified cephalosporinase inactivation methods no inhibition zone around disk,
B) Positive Ceftazidime -cloxacillin is a double-disk synergy test
C) Modified hodge test for AmpC detection in E.coli positive as clover leaf shape
Modified Hodge test n=23 mCIM
n=23 CC-DDS
Result
14 23
17 Positive
9 0
Negative 6
However, this is not certain and resistance can be due to disorder in the permeability of bacteria external membrane and may have no enzymatic sources (Nikaido & Pagès, 2012) .
AmpC b-lactamases are a new threat because they confer resistance to 7-methoxy- cephalosporins like cefoxitin or cefotetan, are unaffected by commercially available b-lactamase inhibitors, and can confer carbapenem resistance in strains lacking outer membrane porins., (Philippon et al., 2002). The widespread use of cephamycins and β-lactamase inhibitor combinations (e.g. clavulanic acid/amoxicillin and tazobactam/piperacillin) has contributed to selection of AmpC β-lactamase producing strains, worldwide (Najjuka et al., 2019) .
Genotypic Detection :
The polymerase chain reaction results of twenty-three isolates showed the highest prevalence for blaFOX gene was detected in 13 isolate (56.5%), blaACC gene was detected in 12 isolate (52.1%) , bla DAH gen was detected in 12 isolate (52.1%),8 isolated (34.7% ) had blaCIT gene , bla EBC Where was identified in 6 isolate (26.08), while the lowest percentage for blaMOX gene was identified in 5 isolate (21.7%) figure 3 , 4 , 5 , 6 , 7 , 8,9.Study In Najaf Hospitals detected blaFOX (44.4%), blaCIT (38.9%), blaDHA (27.8%), and blaEBC (50%) (Al-jubouri & Alasadiy, 2014).
In study conducted in India hospitals the prevalence ,of BlaCIT gen and blaDHA was equal percent, it was found in 40% ,followed by bla MOX gen in ( 18.3%)while gene of the blaACC type was present in only one isolate. No genes belonging to the bla FOX or bla EBC were detected in this study mentioned (Mohamudha et al., 2012) . Study in Turkey the distributions of the genes for E coli isolate were: 10.1% CIT, 8.08% MOX, 3.03% EBC, and 1.01 FOX genes. Meanwhile DHA and ACC group genes were not detected (Yilmaz et al., 2013). Other study show that blaCIT 78.9%
followed by blaMOX 15.7% bla DAH 15.7, blaFOX 10.5% , bla EBC 5.2 %,and there is no gen belong to bla ACC (Helmy & Wasfi, 2014) .
Figure(3) Distribution of the AmpC genes of all clinical isolates of E.coli
56.50%
52.10%
52.10%
34.70%
26.08%
21.70%
0.00%
10.00%
20.00%
30.00%
40.00%
50.00%
60.00%
blaFOX blaACC
blaDAH blaCIT
blaEBC blaMOX
Figure( 4):Detection of bla FOX gen .
Figure( 5)Detection of bla DAH gen.
Figure( 7):Detection of bla EBC gen
Figure( 8):Detection of bla CIT gene
Figure (6):Detection of bla ACC .
Figure( 9):Detection of BlaMOX
Conclusion
FOX gene was prevalence in most isolates of E.Coli . E.coli isolates which have AmpC genes appeared resistance 100% to Ceftazidime, %), Ampicilin(92%), Ceftriaxone(86%) , Trimethoprim/ Sulfamethoxazole (86%) , Cefepime(70%) ciprofloxacin (62%), Gentamicin(46%) , Cefoxitin ( 14%) and Nitrofurantoin ( 8%).prevalence of resistance to third and fourth generation of cephalosporins among isolates in al Anbar hospitals .
Refernces :
1. Ahmed, M. M., & Al Meani, S. L. (2019). Occurrence of Klebsiella pneumoniae carbapenemase KPC gene in Klebsiella pneumoniaeisolated from patients in Anbar city of Iraq. Annals of Tropical Medicine and Health, 22, 108–116.
2. Al-jubouri, S. A., & Alasadiy, Y. D. K. (2014). Molecular Detection of AmpC Family Genes Encoding Antibiotic Resistance among Escherichia coli isolated from Patients with Urinary Tract Infection (UTI) in Najaf Hospitals. Kufa Journal For Veterinary Medical Sciences, 4(1), 152–161.
3. Al Meani, S. A. L., Ahmed, M. M., & Abdulkareem, A. H. (2020). Synergistic Effect between Zingiber Officinale Volatile Oil and Meropenem against Acinetobacter Baumannii Producing-Carbapenemase Isolated from Neurosurgery in Iraq. Systematic Reviews in Pharmacy, 11(9), 920–925.
4. Bush, K., & Bradford, P. A. (2020). Epidemiology of β-lactamase-producing pathogens. Clinical Microbiology Reviews, 33(2).
5. Clinical And Laboratory Standars Institute. (2018). M100 Performance Standards for Antimicrobial Susceptibility Testing. In Journal of Services Marketing (Vol. 8, Issue 3). https://doi.org/10.1108/08876049410065598
6. Helmy, M. M., & Wasfi, R. (2014). Phenotypic and molecular characterization of plasmid mediated AmpC β-lactamases among Escherichia coli, Klebsiella spp., and Proteus mirabilis isolated from urinary tract infections in Egyptian hospitals.
BioMed Research International, 2014. https://doi.org/10.1155/2014/171548
7. Hoseini, N., Sedighi, I., Nejad, A. S. M., & Alikhani, M. Y. (2017). Phenotypic and genotypic detection of ampc enzymes in clinical isolates of escherichia coli and klebsiella pneumoniae. Journal of Krishna Institute of Medical Sciences University, 6(3), 10–18.
8. Ibrahim, M. O., & Al Meani, S. A. L. (n.d.). DETECTION OF PLASMID- MEDIATED AMPC β-LACTAMASE GENES AND EVALUATION THE SYNERGISTIC EFFECT OF CLOVE VOLATILE OIL AND ANTIBIOTICS IN CLINICAL ISOLATES OF KLEBSIELLA PNEUMONIA IN IRAQ.
9. Ibrahim, M. S., Khalid, H. M., & Mero, W. M. S. (2020). Molecular Characterization of Some Virulence Genes and Antibiotic Susceptibility Pattern among Uropathogenic Escherichia coli Isolated from Patient in Zakho City/Iraq.
Zanco Journal of Pure and Applied Sciences, 32(2), 167–177.
10. Institute, C. A. L. S. (2019). CLSI 2019.pdf.
11. MacFaddin, J. F. (2000). Biochemical Tests for Identification of Medical Bacteria, Williams and Wilkins. Philadelphia, PA, 113.
12. Mohamudha, P. R., Harish, B. N., & Parija, S. C. (2012). Molecular description of plasmid-mediated AmpC β-lactamases among nosocomial isolates of Escherichia coli & Klebsiella pneumoniae from six different hospitals in India. Indian Journal of Medical Research, 135(1), 114–119. https://doi.org/10.4103/0971-5916.93433 13. Najjuka, C. F., Kateete, D. P., Lodiongo, D., Mambo, O., Mocktar, C., Kayondo,
W., Baluku, H., Kajumbula, H., Essack, S., & Joloba, M. (2019). Prevalence of plasmid-mediated AmpC beta-lactamases in Enterobacteria isolated from urban and
rural folks in Uganda. Research Square, 1–21.
https://doi.org/10.21203/rs.2.18489/v1
14. Neamati, F., Firoozeh, F., Saffari, M., & Zibaei, M. (2015). Virulence genes and antimicrobial resistance pattern in uropathogenic Escherichia coli isolated from hospitalized patients in Kashan, Iran. Jundishapur Journal of Microbiology, 8(2).
https://doi.org/10.5812/jjm.17514
15. Nikaido, H., & Pagès, J.-M. (2012). Broad-specificity efflux pumps and their role in multidrug resistance of Gram-negative bacteria. FEMS Microbiology Reviews, 36(2), 340–363.
16. Odongo, I., Ssemambo, R., & Kungu, J. M. (2020). Prevalence of Escherichia Coli and Its Antimicrobial Susceptibility Profiles among Patients with UTI at Mulago Hospital, Kampala, Uganda. Interdisciplinary Perspectives on Infectious Diseases, 2020. https://doi.org/10.1155/2020/8042540
17. Pérez-Pérez, F. J., & Hanson, N. D. (2002). Detection of plasmid-mediated AmpC β-lactamase genes in clinical isolates by using multiplex PCR. Journal of Clinical Microbiology, 40(6), 2153–2162.
18. Philippon, A., Arlet, G., & Jacoby, G. A. (2002). Plasmid-determined AmpC-type β-lactamases. Antimicrobial Agents and Chemotherapy, 46(1), 1–11.
19. Poirel, L., Dortet, L., Bernabeu, S., & Nordmann, P. (2011). Genetic features of blaNDM-1-positive Enterobacteriaceae. Antimicrobial Agents and Chemotherapy, 55(11), 5403–5407.
20. Raeispour, M., & Ranjbar, R. (2018). Antibiotic resistance, virulence factors and genotyping of Uropathogenic Escherichia coli strains. Antimicrobial Resistance &
Infection Control, 7(1), 118.
21. Sah, S. K., & Hemalatha, S. (2015). Extended spectrum Beta lactamase (ESBL) Mechanism of antibiotic resistance and Epidemiology. International Journal of Pharmtech Research, 7(2), 303–309.
22. Yilmaz, N. O., Agus, N., Bozcal, E., Oner, O., & Uzel, A. (2013). Detection of plasmid-mediated AmpC β-lactamase in Escherichia coli and Klebsiella pneumoniae. Indian Journal of Medical Microbiology, 31(1), 53–59.
https://doi.org/10.4103/0255-0857.108723
