Phylogenetic Tree of Gene Enterotoxin B in Staphylococcus aureus Isolated from Dairy Products and Human Stool
Riyam Wissam Hassan 1,Azhar Noory Hussein2
Department of Biology, Collage of Education, University of Al-Qadisiyah, Iraq.
ABSTRACT
Collected 280samples from two different sources, which included samples from dairy products and stool samples for intestinal infection patients suspected of suffering from food poisoning according to the diagnosis of the specialist doctor, distributed on 200 samples of stool samples from patients, and the other source of samples included 80 dairy products. For the period from 1/12/2019 to 1/10/2020.For the isolation of Staphylococcus aureus and to detect the seb gene and characterize from a genetic and phylogeny, the results showed that the Staph. aureus bacteria found in 15 isolates with 20.83% of the dairy product samples, while it was found that it recorded an isolation rate of 9.03% of the total of stool samples from patients.Enterotoxin SEB was detected in Staph.aureus bacteria and in both sources (dairy products and stool samples) through the use of (PCR) technique.
It was proved that the seb gene is present in Staph.aureus bacteria, as the presence of the seb gene was shown at a rate of 33% and 40% for each isolates of the dairy products and stool samples respectively, then analyzed the genetic tree of the seb gene encoding for the production of enterotoxin SEB by means of the Mega X program, and the results of the genetic tree analysis showed a clear genetic variation and mutations with global Staph.aureus isolates, as our isolates taken from Stool samples of the patients and dairy products in the NCBI Database) and accession numbers were given in the GenBank.
Key words: Stahylococcus aureus, Enterotoxin seb gene, Phylogenetic Tree.
INTRODUCTION
The genus Staphylococci spp. is one of the most important bacteria spread on the skin, mucous membranes, and upper respiratory tract in humans and in many other mammals. It is also found in the environment, soil and air, as it is found in various products and foodstuffs and shows resistance to different environmentalconditions(Vasconceloes and Cunha, 2010).Staph. aureus is of great clinical importance and due to its wide spread in nature and its pathogenicity to humans and other epidemics, it has received great attention from researchers all over the worldalthough it is considered a normal flora, it can become an opportunistic pathogen being a common cause of many
food poisoning (Larkin et al., 2009). Food poisoning with Staphylococcus is one of the most common foodborne diseases worldwide and results from ingestion of preformatted staphylococcal enterotoxins (SEs) in food as produced by enterotoxic strains(Kadariya et al., 2014(.Staphylococcus aureus produces enterotoxins (SEs) that can be present in toxic doses in spoiled foods, in addition to bad smell or unusual appearance (Argudin et al., 2010). It was found that there are five main types of enterotoxins (classic SEs called SEA, SEB, SEC, SED and SEE). New genes encoding intestinal toxins have been identified and they are classified from SEG to SEU. One or more of these genes are believed to cause 95% of staphylococal food poisoning (Michael and Ahmed, 2013).Therefore, due to the risk of infection with this bacterium to which humans are exposed, and its possession of multiple mechanisms in the event of infection this study aimed at the molecular detection of the seb gene, as well as the investigation of the evolutionary relationship and convergence ratios (sequence similarity) between local isolates and global isolates in GenBank by conducting a phylogenetic tree.
MATERIALS AND METHODS Collection of Samples
This study extended for the period between 1/12/2019 to 1/10/2020. During this study 280 samples were collected from two different sources.It was distributed to 200 stool samples from patients attending consulting clinics and from patients visiting consulting clinics and those in hospital at Al- Diwaniyah Teaching Hospital, Children and maternity hospital and health centers in city of Al- Diwaniyah, who suffer from intestinal infection and food poisoning, depending on the diagnosis of the specialist.As for the other source of samples it included 80 samples of Dairy Products from local vendors and local markets in Different areas in city of Al-Diwaniyah.
Isolation and Identification
Stool samples were cultured by planning method on the cultures media Blood agar, mannitol salt agar and MacConkey agar then incubated for 24 hours at 37 ° C )Forbes et al., 200).As for dairy products, the method of dilution was used, depending on what was stated in Stukus (1997),Isolates were diagnosed based on the phenotypic properties of bacterial colonies on solid media, and a group of biochemical tests were used, depending on the methods mentioned(Forbes et al., 2007;
Macfaddin,2000).Bacterial isolates were also diagnosed using the vitec system to diagnose the species of the genus Staphylococcusspp.
Bacterial Genomic DNA Extraction
instructions, and the extracted DNA was examined using a Nano Drop Spectrophotometer for measuring the concentration of nucleic acids, as the DNA was detected for the purpose of Determine the DNA concentration and measure its purity by reading the absorbance at a wavelength ranging between 260 - 280 nm.
Primers
The Primers for screening for the identification of the enterotoxin seb gene were designed based on (Jonhson, 1991). These primers were supplied from Macrogen in Koreaand as shown in Table (1).
Table (1)Primers used in this study.
Amplicon Sequence
Primer
478 TCGCATCAAACTGACAAACG
F seb gene
GCAGGTACTCTATAAGTGCC R
Prepare PCR Master Mix
The polymerase chain reaction mixture was prepared using the kit AccuPower® PCR PreMixEquipped by the Korean company Bioneer according to company instructions and as shown in Table (2).
Table (2) components of the polymerase chain reaction.
Gel Electrophoresis
Theelectrophoresis of PCR product of the enterotoxin seb gene through gel electrophoresis,By using an agarose gel prepared at a rate of 1.5% under a voltage of 100 volts and a current of 80 amperes for an hour, for the purpose of reading the result of the PCR product.
DNA Sequence Method
A phylogenetic tree analysis was performed to determine the genetic sequence of the enterotoxin seb gene in Staph.aureus in some samples by molecular genetic analysis using the phylogenetic tree program (Mega X).And calculate the evolutionary distance of strains by the maximum method using (UP GMA), by performing genetic tree analysis between local Staph.aureus isolates and global standard isolates, then inserting Staph.aureus isolates specific to the seb gene NCPI- GenBank to obtain an accession number in the genebank (GenBank).
Volume (ML) PCR Master mix
5 DNA template
1.5 F. primer
Primers
1.5 R. primer
12 PCR water
20 Total Volume
RESULTS AND DISCUSSION
Dairy products and stool samples were cultured on culture media, and bacterial isolates were diagnosed based on the phenotypic characteristics of the bacterial colonies on solid media, The results of this study showed that the number of Staph.aureus isolates from dairy products was 15, with an isolation rate of 20.83%. Through these results, we conclude that the presence of these bacteria in a high percentage in these products is an important indicator because it may result in cases of food poisoning as a result of eating these products, When comparing the results of our study with other studies in terms of the percentage of isolation of Staph.aureus bacteria from dairy products, we find that it is close to what Santana obtained (2010), as it was found that its isolation rate reached 18.80%, while we find it little compared to what Al-Khafaji and his group obtained (2013) in the samples of dairy products taken from the local markets in Baghdad as their isolation rate reached 48%,As for stool samples the results showed that Staph. aureus bacteria formed an isolation rate of 9.03%. The results of this study in terms of isolating Staph.aureus bacteria from stool samples agree with the study of Kates and his group (2018), as the rate of isolation reached 9.3%, while This isolation rate does not coincide with what Akingbade and his group (2013) have found, as they found that the isolation rate reached 4.4%. The reason for the discrepancy in these isolation rates may be due to the difference in the size of the samples and may also be attributed to differences in the environmental conditions from which the samples were isolated.
Detection of Gene seb Encoding Enterotoxins SEB
The seb gene encoding for the production of enterotoxin SEB was investigated in both sources of isolates taken through the use of PCR technique, it was found that the gene amplification product after it was carried on the agarose gel 1.5% and examined under ultraviolet radiation contained five isolates of Staph. aureus isolated from dairy products on the seb gene at 33% and with a product 478 bp (Fig 1),also found that Staph.aureus isolates from stool samples taken from patients were contains of the seb gene by 40% with a product size 478 bp (Fig 2).This result was different with Blaiotta and his group (2004) as they did not record the presence of this gene in any of the samples dairy products samples, while the percentage of isolation of this gene from stool samples of patients was higher than that obtained by Shin and his group (2016) as they found that this gene formed an isolation rate of 1.3% from fecal samples associated with food-borne diseases. The production rate of the seb gene may be due to various factors, including the type of strain of Staph.aureus, which causes infection (Jumaily and Saeed, 2014).
Figure (1) electrophoresis of agarose gel (1.5%), voltages (100) and voltage difference (80) ampere for one hour, which shows the results of the PCR examination for the detection of enterotoxin seb in Staphylococcus aureus
isolated from dairy products. M (Marker ladder 1500-100bp) represents isolates (3,4, 7,11,12) test positive bacterial isolates with a product 478bp.
Figure (2) electrophoresis of agarose gel (1.5%), voltages (100) and voltage difference (80) ampere for one hour, which shows the results of the PCR examination for the detection of enterotoxin seb in Staphylococcus aureus isolated from stool samples. M (Marker ladder 1500-100bp) represents isolates (2, 5,7,10,12,14 ) test positive
bacterial isolates with a product 478bp.
Phylogenetic Tree Analysis of the seb gene encoding for the production of enterotoxin SEB A phylogenetic tree was analyzed for the seb gene that encodes for the production of enterotoxin (SEB) in Staph.aureus, which was isolated from stool samples from patients and samples of Dairy Products.The data were analyzed sequence based on the tools of the National Center for Biotechnology Information (NCBI), using NCBI Blast by comparing them with the specific source sequences (RefSeq).(Fig 3) shows the results of analyzing the genetic tree for the gene in local Staph. aureus isolates and global standard isolates mediated by the Mega X program, as two seb gene samples were taken, one from the stool samples of the patients and the second from the samples of dairy products (milk), and after comparing the results with global isolates, the gene in our local isolates showed clear genetic variation (Variation and Mutations), as our isolates taken from stool samples of patients and dairy products were recorded in the center's database The National Bioinformatics Technology (NCBI Database) and accession numbers were given in GenBank (MW084650) and (MW084651) for each of the stool samples and dairy products respectively.
Figure (3): Phylogenetic tree analysis using MEGA X partial sequencing software for the seb gene, in local Staph.aureus isolates with global isolates shown in the genetic tree analysis.
The results presented in Table (3) showed the convergence ratios of our local isolates represented by the two isolates IQ-No.1 and IQ-No.2 from stool samples of patients and samples of dairy products respectively with global isolates, the two isolates gave different proportions that match The reason why our local isolates do not completely match global isolates to biological diversity in many pathogens, which results in the occurrence of large variations. Through this, we conclude that the genetic tree represents an important representative scheme for the relationships between the different types of organisms (Choudhuri, 2014.) These results, which clarified the rates of convergence between Staph.aureus isolates and global isolates, came to confirm the correct and accurate diagnosis of our local isolates after they were compared with global isolates, and thus they may be useful from a diagnostic aspect. It is also possible to obtain additional information about the structural and functional relationships of intestinal toxins in particular. There are no studies on the nitrogen base sequences of the seb gene at the local level and so this data obtained in our local isolates can be utilized in the NCBI database.
Table (3) Convergence ratios between local and global Staph.aureus isolates.
Identities
IQ- No.2)) MW084651 )IQ- No.1)
MW084650 Sequence ID
Bacterial Isolates
84.64
%
%80.06 KX168631
Staph. aureus
%84.42
%79.88 EF614239
Staph. aureus
%83.70
%79.75 AB462487
Staph. aureus
%83.70
%79.75 KC428707
Staphylococcus spp.
%83.70
%79.75 KX168628
Staph. aureus
%84.33
%79.75 KX168629
Staph. aureus
%85.00
%81.21 KU736827
Staph. aureus
%84.43
%80.21 MF621929
Staph. aureus
%85.21
% 81.25 EF585248
Staph. aureus
%85.71 82.05
% KU666551
Staph. aureus
%85.71 82.05
% KU697311
Staph. aureus
The results shown of the alignment analysis in (Fig 4) for the first local isolate of stool samples (IQ- No.1) (MW084650) and (Fig 4) for the second local isolate (IQ-No.2) (MW084651) for dairy products, which showed variations in comparison with global isolates. Through these results, we conclude that there is a variation in the sequence of nucleotides in many sites and this may result in a change in the amino acid sequence. It was found that the enterotoxin SEB shows a high level of variability. In the sequence between different strains, this is attributed to the presence of pathological islets (SaPIs) carrying SEB and correlating them with differences in the levels of production of the seb gene (Sato'o et al., 2013, Qasim and Al-Mayali, 2019).
Score Expect Identities Gaps Strand
226 bits(122) 8e-63 257/321(80%) 13/321(4%) Plus/Plus
Query 1 GCATAATGGATACCAATTACGTATTAACAT-TTGAAGTATTACTGTCAGCAAACTTGACG 59 Sbjct 1 ...A...-.-.-...-..A.A...T..GGT.T....A. 56
Query 60 ATGGTAGAAACTTATTATCTATTGAAGT-GAAAC-CATTAG-TAAAAGGGACTGCCCAAG 116 Sbjct 57 ...A...T...T....C..AC....TA..A..AA...T...T.... 116
Query 117 AAATCTCCTACCTAACTCGTCACTATTTGCCGAAAGCTATAAAACTCTATGAATTTAACA 176 Sbjct 117 ..T.AGAT...GT....AA..A... 176
Query 177 ACTCGCCTTATGAAACGGGGCG-ATTAAATTTATAGAAAGAGAGAATAGCTTTTCACCTG 235 Sbjct 177 ...ATAT...T...GGTA.. 236
Query 236 ACATGACGCCTG-ACCAGGAGATTTC-TTGACCAGTCTAAATTTTCTAA-GTAGTTCGAT 292 Sbjct 237 ...T...C...AAAT...A...A..-...T.AT..A.A.. 295
Query 293 GGTCATAAGATGATTGATTCT 313 Sbjct 296 .A.A....AT..G... 316
Figure (4) a multi-alignment analysis of the nitrogen base sequences of the seb gene in the Staph.aureus isolate (IQ-No.1). The multi-alignment analysis showed a match to the global isolates with the sign (*) as well as with
substitution mutations in the seb gene.
Score Expect Identities Gaps Strand
311 bits(168) 3e-88 270/319(85%) 7/319(2%) Plus/Plus
Query 5 GCATAATGGATACCATTTAGTATTAATATAGAAG-ATTACTGTCAGCG-ACTTCACGATT 62 Sbjct 1 ...A....A....-..A...T...T..G.T.T..G.A...G 59
Query 63 TTAAAAACTTATTATCTATTGA-ATTGAAACTAATAAGAAAAAAGGAACTGCCCAAGAAA 121 Sbjct 60 G...T...T....CG.AC...TG...T...T 119
Query 122 TCGACTACCTAACTCGTCACTATTTGCCGAAAGCTAAAAAACTCTATGAATTTAACAACT 181 Sbjct 120 .A..T...GT....AA... 179
Query 182 CGCCTTATGAAACGGGATATATTAAATTTATAGAAAGAGAGAATAGCTTTTCACCATGAC 241
Sbjct 180 ...T...GGT-... 238
Query 242 ATGACGCCTGCACCAGGAGATATTCTTGACCAGTCTAAATTTTCTAA-GTAGTTCGATGA 300 Sbjct 239 ....T...AAT...A...A..-...T.AT..A.A.... 297
Query 301 TCATAAAATGATTGATTCT 319 Sbjct 298 .A...T..G... 316
Figure (5) a multi-alignment analysis of the nitrogen base sequences of the seb gene in the local Staph.aureus isolate (IQ-No.2). The multi-alignment analysis showed a match with the global isolates (*) as well as substitution
mutations in the seb gene.
CONCLUSION
It was found that Staph.aureus bacteria is one of the main pathogens found in dairy products and also its found in hospitals in Diwaniyah city as a pathogen, in addition to being considered a normal flora and thus its presence may result in some health problems,Alsofound from the analysis of the genetic tree of a geneseb in local Staph. aureus isolateswhen compared with global isolates, showed clear genetic variation and mutations. Therefore, exposure to genetic mutations may cause the emergence of dangerous types in the community of Al-Diwaniyah, which may lead to frequent infections or even difficult treatment.
REFERENCES
1. Akingbade, O.A.; Akinjinmi, A.A.; lasunkanmi, O.I.; Okerentugba, P.O.; Onajobi, B.I.
and Okonko, I.O.(2013). Bacterial Organisms Isolated From Children with Diarrhoea In Abeokuta, Nigeria. Stem. Cell., 4(4):5-9.
2. Akingbade, O.A.; Akinjinmi, A.A.; lasunkanmi, O.I.; Okerentugba, P.O.; Onajobi, B.I.
and Okonko, I.O.(2013). Bacterial Organisms Isolated From Children with Diarrhoea In Abeokuta, Nigeria. Stem. Cell., 4(4):5-9.
3. Al-Khafaji, M.H.; Flayyih, M.T. and Sabah, A.(2013). Isolation, Identification and Detection of Some Virulence Factors of Staphylococci in milk and cheese in Baghdad.
Iraq.J. Sci., 54(4):1057-1067.
4. Anstead, G.M.; Cadena, J. and Javeri, H. (2014). Treatment of Infections Due to Resistant Staphylococcus aureus. In: Ji Y. (eds) Methicillin-Resistant Staphylococcusaureus (MRSA) Protocols. Met. Mol. Bio., 1085: 259-309.
5. Argudin, M. A.; Mendoza, M. C. and Rodicio, M. R. (2010). Food poisoning and Staphylococcus aureus enterotoxins. Toxins 2., 1751-1773.
6. Bhunia, A.K. (2008). Food born bacterial pathogen. Springer. Purdue University West Lafayette. IN. USA.,:125-134.
7. Blaiotta, G.; Ercolini, D.; Pennacchia, C.; Fusco, V.; Casaburi, A.; Pepe O. and Villani F.(2004). PCR detection of staphylococcal enterotoxin genes in Staphylococcus spp. strains isolated from meat and dairy products. Evidence for new variants of seg and seI in S. aureus AB-8802.
8. Choudhuri, S .(2014). Bioinformatics for Beginners: Genes, Genomes, Molecular Evolution, Databases and Analytical Tools. Elsevier.
9. Forbes, B. A.; Daniel, F. S. and Alice, S. W. (2007). Bailey and scott's diagnostic
10. Jonhson, W.M. (1991). Detection of genes for enterotoxins, exfoliative toxins, and toxic shock syndrome toxin 1 in Staphylococcus aureus by polymerase chain reaction. J. Clin.
Microbiol., 29: 426-30.
11. Jumaily, E.F.and Saeed, N.M.(2014). Detection of Enterotoxin Types Produce by Coagulase Positive Staphylococcus species Isolated from Mastitis in Dairy Cows in Sulaimaniyah Region. App. Sci. Report., 6: 19-26.
12. Jumaily, E.F.and Saeed, N.M.(2014). Detection of Enterotoxin Types Produce by Coagulase Positive Staphylococcus species Isolated from Mastitis in Dairy Cows in Sulaimaniyah Region. App. Sci. Report., 6: 19-26.
13. Kadariya, J.; Smith, T.C. and Thapaliya, D. (2014).Staphylococcus aureus and staphylococcalfood-bornedisease: an ongoin gchallenge in public health. Bio. Res. Int., 827965.
14. Kates, A.E.; Thapaliya, D.; Smith, T.C. and Chorazy, M.L.(2018). Prevalence and molecular characterization of Staphylococcus aureus from human stool samples. Anti. Res.
Infect. Cont., 7(42): 1-9.
15. Larkin, E.A.; Carman, R.J.; Krakauer, T. and Stiles, B.G. (2009).Staphylococcus aureus. the toxic presence of a pathogen extraordinaire. Curr. Med. Chem., 16(30): 4003- 4019.
16. MacFaddin, J.F. (2000). Biochemical tests for identification of medical bacteria. 3nd ed. the Williams and Wilkins. London.
17. Michael, N. and Ahmed, S.(2013). Detection and Identification of Staphylococcus aureus Enterotoxins in Some Milk Products and their Handlers. Egyptian .J. Med. Microbiol., 22:101-111.
18. Santana, E.H.W.; Cunha, M.L.R.S.; Oliveira, T.C.R.M.; Moraes, L.B. and Alegro, L.C.A. (2010). Assessment of the risk of raw milk consumption related to staphylococcal food poisoing. Ciencia Animal Brasil., 11: 643-652.
19. Sato’o, Y.; Omoe, K.; Ono, H.K.; Nakane, A. and Hu, D. L. (2013). A novel comprehensive analysis method for Staphylococcus aureus pathogenicity islands. Microbiol.
Immun., 57:91-99.
20. Shin, E.; Hong, H.; Park, J.; Oh,Y. Jung, J. and Lee, Y.(2016). Characterization of Staphylococcus aureus faecal isolates associated with food-borne disease in Korea. J. Appl.
Microbiol.,121: 277-286.
21. Stukus,P.E. (1997). Investigating microbiology: A laboratory manual for general microbiology. Harcourtbrace and Company. Philadelphia, USA. P: 169- 467.
22. Tong, S.Y.; Davis, J.S.; Eichenberger, E.; Holland, T.L. and Fowler, V.G.
(2015). Staphylococcus aureus infections: epidemiology, pathophysiology, clinical manifestations, and management. Clin. Microbiol. Rev., 28 (3): 603-61.
23. Vasconceloes, N.G. and Cunha, M.R.S. (2010). Staphylococcal enterotoxin. Molecular Aspect and Dtection Method., 2(3): 29-42.
24. Qasim M T and Al-Mayali H K (2019) . Investigate the relation between Baicalin effect and gene expression of LH, FSH, Testosterone in male rats treated with Gemcitabine drug. Research Journal of Pharmacy and Technology,12 (9),4135-4141.
25. Qasim MT, Al-Mayali HK (2019). The immunological and protective role of baicalin in male rats treated with chemotherapy (Gemcitabine). Journal of Physics Conference Series;1234:012065.
