View of Phenotypic and Molecular Detection of Streptococcus Uberis Isolated From Milk of Subclinical and Clinical Mastitis of Cow in Basrah City

Phenotypic and Molecular Detection of Streptococcus Uberis Isolated From Milk of Subclinical and Clinical Mastitis of Cow in Basrah City

Basima M. Atea^*Nawres N. Jabber ^**

Department of Microbiology and Parasitology,College of Veterinary Medicine, University of Basrah Basrah, Iraq

*[email protected]

**Correspond author: [email protected]

Abstract

Streptococcus uberis is found as commensals on the mucosa of the tonsils and intestinal tract of cows and responsible for approximately 20-30% of clinical mastitis cases in dairy cows .S.uberis is a gram positive coccus facultatively anaerobic and catalase negative and the key characteristics of S.uberis are the hydrolysis of esculine and production of acid on inuline ,S.uberis is responsible for infection in clinical and subclinical mastitis cows.Atotal of 100 milk samples was collected from clinical and subclinical mastitis cows from different dairy farm in Basrah province for detection of some phenotypic and genotypic characterization and detection of some virulence genes of S.uberis by PCR techniques and biofilm formation were assayed by quantitative microtiter plate. Antibiotic susceptibility performed using conventional assay method. Result revealed that ,The percentage of S.uberis isolated from the total examined milk sample was 46% in studding the phenotypic characteristic on sheep blood agar was found that alpha –hemolysis and negative camp factor like reaction and slime production as indictor for biofilm formation were detected in all the isolates .the study of virulence gene (sua 93.7%)(cfu 66.6%)(hasA 62.5%) in the present study usednine antimicrobial

,amoxillin(58.6%),ampicillin(100%),ciprofloxacin(69.5),ciftrixone(93.4),erythromycin(76%),trimeth oprim(95%), gentamycin(100%),tetracycline(10.8),penicillin(45.6%).

Key words: S.uberis; mastitis; virulence factors; antimicrobial sensitivity; biofilm

Introduction

Bovine mastitis has been reported as the most important disease on dairy farms, because of the reduction of farm profitability, decreased milk production, discarded milk, treatment costs, and culling.[1]Essentially, there are two classes of mastitis: clinical and subclinical.Clinical mastitis is inflammation of the udder that can be observed by changes in the milk characteristics and in the normal constitution of the udder[2]Subclinical mastitis is inflammation of the udder that shows no external changes in the milk or on the udder[2].S uberis is a commensal bacteria present on the tonsil and intestinal mucosa of dairy cows in North America, Europe, and

Australia. It is responsible for 20–30% of clinical mastitis cases in dairy cows.[3].

S. uberis is a Gram-positive coccus with a diameter of less than 2 m that grows by cell division in one plane, resulting in a linear array of nascent cells. Its nutritional requirements are complex and variable, indicating that it has evolved as a commensal or pathogen. It is facultatively anaerobic and catalase negative.[3].Colonies are convex, moist with dense centers. On sheep blood agar ,approximately 15% of isolates produce β-haemolysis. The hydrolysis of esculin is one of the most important biochemical diagnostic features of S.uberis.[4] and production of acid from inulin.Streptococcus uberis is the most common organism isolated from the mammary gland of non-lactating multiparous cows during the non-lactating period, and it is the cause of infection in clinical and subclinical mastitis cows..[5] It causes subclinical mastitis, which progresses to clinical mastitis, as well as acute and chronic mastitis in the infected mammary gland, which can last for more than one lactation.[6] During early lactation and at the end of lactaion, the occurrence of S. uberis mastitis is greatest.[7] Mastitis caused by S. uberis is also normal during the dry period before calving. S. uberis was found to be the cause of approximately 20% of mastitis cases at calving, and over 50% of quarters infected with S. uberis during the dry period developed clinical mastitis. Differences in the 16S and 23S rRNA genes differentiate Streptococcus uberis is distinct from the phenotypically similar but less common Streptococcus parauberis. As a consequence, it's well-equipped to deal with a variety of situations, including those encountered as a commensal. a pathogen of the mammary gland, a contaminant in the environment, or a pathogen of the bovine intestine[3]

This study is aimes to Isolation and identification of Streptococcus uberis, detection of some virulence genes from the isolated bacteria by PCR technique and characterization of biofilm formation .

Materials&Methods

Collection of milk samples

The current research contained a total of 100 milk samples, 50 of which were obtained from clinical mastitic cows and 50 from subclinical mastitic samples. Physical examination and a California mastitis test were used to obtain quarter milk samples from farms during a single visit during milking time (CMT).[8].

Bacteriological isolation:

Milk samples were streaked onchrom agarthen on 7 percent sheep blood agar, in a standard loop (Himedia, Mumbai, India). The plates were inoculated and incubated aerobically at 37°C.

After 24-48 hours, the plates were tested for growth. The colony size, form, color, haemolytic

characteristics, Grams staining, and catalase test, coagulase and oxidase were used to identify Streptococci, especially S. uberis.[9]

Phenotypic characterization of S. uberis:

1-Colony characteristic on Edward's media as selective medium for S.uberis:

Colonies that were primary identified as Streptococci were streaked on Edward's media plates as a selective medium, incubated at 37oC and examined after 24-48 h for growth and change in colour of the medium. The presence of growth, haemolysis and esculin hydrolysis (dark background) were indications of S. uberis. Then, colonies which grew on Edward's media were picked and streaked on macConkey agar, S. uberis was identified by the lack of growth on the agar. According to[9] the isolates were first described using standard biochemical tests.to . Since S. uberis is a fastidious bacterium, so it was sub-cultured on brain heart infusion agar for further PCR assays.

2-CAMP factor like reaction

Bacteria were screened for CAMP factor activity as previously described by[10]. Briefly, S.

uberis strains were streaked perpendicular to a streak of β-haemolytic S. aureus on blood agar plates and after 6-20 h incubation at 37°C, they were observed for haemolysis.

Genotypic characterization of S. uberis:

1- DNA extraction from Streptococcus isolates:

The DNA was extracted and purified according to the instructions of the company (Geneaid, Lot No. FC26108-G/Korea). All Streptococcus speciesisolates had been grown in 5 ml of Brian heart infusion broth over night at 37 °C.

2- Detection of HSP40 gene

Fourty six S.uberis isolated from animals were subjected for PCR assay to detect the presence of Hsp40, (Table 1) ,[11]

3- Detection of SUA, CFU, HASA virulence genes for S. uberis

All the isolates which were confirmed were subjected to PCR for the detection of genes that responsible for virulence Sua, Cfu , HasA genes in S. uberis, table ( 1),[12]

Primer name

Sequence 5-3 Target taxon/gene

T C PRIMER SIZE

Taple (1 ): Primer used in the study

Detection of slime production by Congo red agar method:

Cultivation of S. uberis isolates on Congo red agar (CRA) plates was used to assess slime production as a biofilm formation indicator. as described by[13]. The colony phenotypes of isolates were used to interpret them. Slime production was considered a positive indicator in black colonies with a dry consistency and rough surface and edges, whereas intermediate slime producers were black colonies with a smooth, round, and shiny surface and red colonies with a dry consistency and rough edges and surface. Colonies that are red and have a sleek, round look.

Quantification of biofilm formation on the microtiter plate

Biofilm formation was assayed phenotypically by the ability of cells to adhere to the wells of 96 –well microtiter plate as described by[14].Briefly ,A10ml of cell suspesion having 0.5OD600 was inoculated in 190 ml TSB medium in each well and 200ml was pourd into the wells .the negative control wells contained 200ml of TSB suplemented with 1% glucose.the tissue culture plates were incubated for 16 hours at 37C .after incubation plates are washed twice with phosphate buffer saline or sterile water and air dried .then added 200ml of crystal violet solution (0.2%)to all wells.after amint the excess crystal violet was removed and plates were washed twice and air –dried Finally, bound crystal violet was dissolved in 33% acetic acid.Biofilm,growth was monitored in terms of O.D(570nm) using,microplate reader .using ELISA reader .optical density cut off (ODc) was determined. It is defined as average ,OD of

Hsp40 AATTACGAGGTGCTGGACAA

TTCTTGACCACTTGCCTCAG (chiang et al,2008)

S.uberis 62 119 bp

Sua TCAACTTGACGAATCGCTTG

TCAGCCATTGTTTCTGCTTG

Adhesion molecule

50 480pb

Cfu TATCCCGATTTGCAGCCTAC

CCTGGTCAACTTGTGCAACTG

CAMP factor 50 205bp

HasA GAAAGGTCTGATGCTGATG

TCATCCCCTATGCTTACAG

Hyaluronic acid capsule

44 319bp

negative control +3*standard deviation(SD),of the negative control.Biofilm –production is considerd .

Non biofilm producer = (OD ≤ ODc ),0

Weak biofilm producer = (ODc < OD ≤ 2* Odc),+

Moderate biofilm producer =( 2*ODc < OD ≤ 4*Odc),++

Strong biofilm producer =( 4* ODc < OD),+++

Antibiotic susceptibility testing of the isolated S. uberis:

Antimicrobial susceptibility of S. uberis strains to 14 antibiotics using Disk diffusion technique was performed according to the National Committee for Clinical LaboratoryStandards (NCCLS, 2008) on Mueller Hinton agar (Himedia, Mumbai, India) using commerciallyavailableantimicrobialtestdiscs.gentamycin,tetracyclin,pencilin,erythromycin,ceft rixone,amoxycillinResults were recorded by measuring the inhibition zonesand scored as sensitive, intermediate susceptibility and resistant according to the NCCLS recommendations.

Results

Bacteriological isolation:

A chromogenic medium for isolation and differentiation of streptococcus species as a specific bacteria that grow with different colony appearance. There are different variants of chromogenic agar which can be used for cultivation and sometimes for differentiation of bacteria. The results of bacterial isolation, show that S. uberis colonies appear as metallic blue fig (1 ). . After enrichment, the samples were streaked on sheep blood agar and incubated at 37 °C for 18 h. Subsequently, single colonies suspected to be S. uberis small and circular colonies with smooth edge , gives alpha –hemolysis fig (2). All sample were stained with Gram's staining and examined by alight microscope to notice Gram's reaction, shape and cell arrangements .The typical colonies that showed Gram-positive cocci occurring in long chain were taken as presumptive streptococcus fig ( 3 )

Fig ( 1 ) metallic blue colonies of S. uberis on chrom agar

Figure( 2 ):streptococcus uberis on blood agar show alpha hemolysis

Figure( 3) Gram staining ofstreptococcus uberis

Biochemical test for the isolated bacteria .

Specific biochemical tests were used for detection of streptococcui these biochemical tests were catalase, oxidase ,coagulase all streptococci isolates showed negative catalase , coagulase and negative oxidase table( 2 )

Table ( 2 ) biochemical test for the isolated bacteria

Bacteria catalase Coagulase Oxidase

Streptococcus uberis _ _ _

Phenotypic characterization of S. uberis:

1- Colony characteristic on Edward's media as selective medium for S.uberis:

The colonies that were identified on blood agar were streaked on Edward media plates and incubated at 37 ^oc and examined after 24-48 hours for growth and change in colour of the medium. The presences of growth, blue to metallic blue color and esculin hydrolysis (dark background) were one indication of S. uberis fig ( 4 ) .

Figure( 4) streptococcus uberis on Edward media

2- CAMP factor like reaction

CAMP factor like reaction, S. uberis strains were streaked perpendicular to a streak of β- hemolytic S. aureus on blood agar plates . Enhanced hemolysis is indicated by an arrow head- shaped zone of beta-hemolysis at the junction of the two organisms , S. uberis show negative result , fig ( 5)

0 50 100

Clinical mastitis Subclinical mastitis

Total

% of S. uberis isolates from bovine mastitis

S. uberis

Fig (5 ) : Camp test in Streptococcus uberis(negative) Numbers and percentage of Streptococcus uberis.

The results of bacterial identification depending on morphological ,microscopical and biochemical test ,show the percentage of Streptococcus uberis 56% from subclinical mastitis and 36% from clinical mastitis table ( 3 ) , fig ( 6)

Table (3):Numbers and percentage of Streptococcus uberis isolates from bovine mastitis

Fig ( 6 ) percentage (% ) of S. uberis isolates from bovine mastitis Genotypic characterization of S. uberis:

Sample source NO.sample NO.of S . uberis %

Clinical mastitis 50 18 36

Subclinical mastitis 50 28 56

Total 100 46 92

1- DNA extraction from Streptococcus isolates:

A total of 46 S. uberis and 24 S.agalagtia isolates were identified by using conventional microbiological technique and biochemical tests , these isolates were subjected to DNA extraction fig ( 7 ) . The concentration of DNA was estimated by nanodrop

Fig (7 ) Total genomic DNA extracted from isolates using 2% agarose gel electrophoresis 2- Detection of HSP40 gene

A total of 46 isolates were confirmed as S. uberisby detection of HSP40 gene by PCR technique , the size of product was 119bp . The percentage of positive results for the genes was 100% , fig ( 8) .

Fig ( 8 ) Gel electrophoresis of amplified HSP40 gene of S. uberis using conventional PCR ( lan 1-12 ) .M. marker Agarose 2% and TBE( 1X ) at 75V/cm for 90 min . stained with safe stain, and on a UV transilluminator .

3- Detection of SUA, CFU, HASA virulence genes for S. uberis

All the isolates which were confirmed were subjected to PCR for the detection of genes that responsible for virulence Sua, Cfu , HasA genes in S. uberisThe results revealed that Sua gene

119 500 200 1000 2000

M

119

1 2 3 4 5 6 7 8 9 10

was found in 100% of S.uberis isolates ,displayed clear band of approximately 480bp . On the other hand the results of PCR amplification for Cfu gene and HasA gene were detected in 69.5 % and 65.2%,displayed clear band of approximately 205bp and 319bp respectively, fig ( 9,10,11 ) , table (4 ).

Fig ( 9 ) Gel electrophoresis of amplified Sua gene of S.uberis using conventional PCR ( lan 1-12 ) .M. marker Agarose 2% and TBE( 1X ) at 75V/cm for 90 min . stained with safe stain, and on a UV transilluminator .

Fig ( 10 ) Gel electrophoresis of amplified

Cfu

100 480 1500

M 1 2 3 4 5 6 7 8 9 10

100 205 500 1000

M 1 2 3 4 5 6 7 8 9 10 11 12

319 100 500 1500

M 1 2 3 4 5 6 7 8 9 10

Fig ( 11 ) Gel electrophoresis of amplified

HasA

Table (4): Number of samples and percentage of positive results for virulence genes detection in streptococcus uberis isolated from bovine mastitis.

Detection of slime production by Congo red agar method:

Slime production is an indicator for biofilm formation was evaluated by cultivation of S. uberis isolates on Congo red agar (CRA) plates . Isolates were interpreted according to their colony phenotypes. Black colonies with dry consistency and rough surface and edges were considered a positive indication of slime production, while both black colonies with smooth, round and shiny surface and red colonies with dry consistency and rough edges and surface were considered as intermediate slime producers fig ( 12 ) .

Fig ( 12 ) slime production by S. uberis on Congo red agar Quantification of biofilm formation on the microtiter plate

The results of the microtiter plate assay of all S. uberis isolates, show different levels of biofilm production were detected as strong , moderate and weak ((42%, 35 %, and 28 %) respectively

The genes No. of samples No. of positive %

Sua 46 45 97.8%

CFU 46 32 69.5%

HaSA 46 30 65.2%

from Subclinical Mastitis , and (44% , 33% and 22% ) from Clinical Mastitis figure (13) , table ( 5 ) .

NC = Negative control, S= strong, M= Moderate, W= weak

Fig( 13 ) The biofilm formation by S. uberis on the microtiter plate.

Table (5): Results of microtiter plate assay of biofilm formation by S. uberis isolates.

Sample NO.of

S.uberis

Biofilm production No./(%) Total No.of biofilm producer Weak

producer

Moderate producer

Strong producer

Subclinical

Mastitis 16

14(100%)

0 2(14.28%) 12(85.71)

Clinical Mastitis

6 6(100)

0 2(33.33%) 4(28.57%)

Non – biofilm produer ( OD < ODc ) , 0

Weak biofilm producer ( ODc < OD < 4x ODc ) , +

Moderate biofilm producer ( 2x ODc < OD < 4x ODc ) , ++

Strong biofilm producer ( 4xODc < OD )+++

Antibiotic susceptibility testing of the isolated S. uberis:

The results of antibiotic susceptibility testof 9 different antibiotics by disc diffusion methodagainst 24 S. uberisisolates Amoxillin ((sensetive 45.6%,tntermidiat 0%,resistent58.6%) , Ampicillin (senstive 4.3%,.intermediat 0% ,resistent 95.6%) ,Ciprofloxacin(sensitive 69.5%, intermediat 0%,resistent30.4%), Ciftrixone (senstive 93.4%,intermediat6.52%,resistent0%), Erythromycin (sensitive 21.7%%,intermediat 2.17%,resistent76%) , Trimethoprime (sensitive 4.3 %,intermediat 0%,resistent95.6%) ,Gentamycin (sensitive100%) ,Tetracycline (sensitive 10.8%,intermediat 0%,resistent 89.1%) , Pencillin (sensitive 4.3%,intermediat 0%,resistent 95.6%) fig ( 14 , 15) table ( 6 ) .

Fig ( 14 ) :Disc diffusion method with inhibition zones for some antibiotics against S. uberis

Fig ( 15 ) The percentage of antibiotic Susceptibility Testing of S. uberis

45.6 4.3

69.5

0 21.7 4.3 0 10.8 4.3

0 0 0 6.52 2.17 0 0 0 0

58.6 95.6

30.4 0

76 95.6 100 89.1

25 0

50 100 150

The percentage of antibiotic Susceptibility Testing of S. uberis

sensetive intermidiat resistant

Table ( 6 ) Antibiotic sensitivity test of 9 different antibiotics by disc diffusion test against 46 S.uberis isolates.

No Antibiotic Con.

No. of isolates

R I S

1 Amoxillin(Ax) (30) 21 - 27

2 Ampicillin(AM) (10) - - 46

3 Ciprofloxacin(cip) (2) 14 - 32

4 Ciftriaxone(CRO) (30) - 3 43

5 Erythromycin (E) (15) 10 1 35

6 Trimethoprime(TE) (5) 2 - 44

7 Gentamicin (CN) (10) - - 46

8 Tetracycline(TE) (30) 41 - 5

9 Pencillin(P) (10) 44 - 2

Con: Concentration; R: Resistant; I: Intermediate; S: Sensitive.

Discussion

Streptococcus uberis is a worldwide pathogen that causes intra-mammary infections in dairy cattle. S. uberis has been described as an opportunistic pathogen that utilizes nutritional flexibility to adapt to a range of ecological niches, including the mammary gland. It was suggested that cow-to-cow transmission of S. uberis potentially occurring in the majority of herds and may be the most important route of infection in many herds[15].

In this study, a total number of 100 different milk samples were collected from clinical, subclinical milk samples of different dairy cow farms aiming to isolate S. uberis that cause bovine mastitis to study its phenotypic and genotypic characteristics. Based on both phenotypic and genotypic identification, the number of Streptococcus spp. isolated from all tested milk samples was 46(92%).

In contrast to the total examined milk samples, the incidence of S. uberis was 46%. Nearly similar, [16] isolated S. uberis from normal, sub-acute and acute cow mastitic cases with a

percentage of 18%. A higher incidence rate of Streptococcus spp. were isolated from mastitic cows (55 %) but a lower S. uberis was isolated with a percentage of 15.3% was detected by[17]. Also, a higher incidence of S. uberis as the predominant pathogen was recorded by[18]

in cow's milk samples (46%). This variation in the results might be attributed to the difference in herd management between herds. Teat dipping before and after milking, washing milkers hands before and after milking, preparing a clean towel for each lactating cow, milking of infected cows, and finally, using dry cow therapy and treating clinical cases at an early stage can all help to reduce the occurrence [19].Antibacterial agents used to treat or prevent mastitis are usually effective against bovine mastitis organisms; however, chronic mastitis is difficult to treat. The ability of bacteria to form biofilms may be one explanation for their failure to react to treatment.[20]

Microorganisms are usually studied in broth cultures. The behavioral features of microorganisms have been discovered information to research focused on broth studies. Broth cultures, which allow organisms to move freely, have long been thought to reflect the dominant (physical and chemical) environment in which organisms live. Consequently, bacterial trends observed in broth cultures were viewed as characterizing an organism’s

Conclusion:

growth and behavioral patterns (Monaghan, J. M., & Hutchison, M. L.S. uberis infections in the mammary gland cause significant economic losses in the dairy industry. Several studies have phenotypically and genetically characterized S.uberis strains in order to improve our understanding of virulence factors and biofilm formation in S. uberis strains. In the future, the results may be used to create more effective and acceptable treatment protocols.

) 2012 alleviate the impact of mastitis caused by this environmental pathogen

. Acknowledgments

The author would like to thank the College of Veterinary Medicine, University of Basrah Iraq

References

1-Mostert, P. F., Bokkers, E. A. M., Van Middelaar, C. E., Hogeveen, H., & De Boer, I. J. M. (2018).

Estimating the economic impact of subclinical ketosis in dairy cattle using a dynamic stochastic simulation model. Animal: an international journal of animal bioscience, 12(1), 145.

DOI: 10.1017/S1751731117001306

2-Blowey, R. W., & Edmondson, P. (2010). Mastitis control in dairy herds. Cabi.

DOI10.1079/9781845935504.0000

3-Abureema, S. (2013). Characterisation of Streptococcus uberis from bovine milk (Doctoral dissertation, Ph. D. thesis, School of Applied Sciences RMIT University, Melbourne, Victoria, Australia).

4-Raemy, A., Meylan, M., Casati, S., Gaia, V., Berchtold, B., Boss, R., ... & Graber, H. U. (2013).

Phenotypic and genotypic identification of streptococci and related bacteria isolated from bovine intramammary infections. Acta Veterinaria Scandinavica, 55(1), 1-9. DOI: 10.18805/ijar.B-3848 5-Pal, M., Regasa, A., & Gizaw, F. (2019). Etiology, Pathogenesis, Risk Factors, Diagnosis and

Management of BovineMastitis:AComprehensiveReview. InternationalJournal, 6,40-55.

https://www.researchgate.net/publication/340264198

6-Mekonnin, E., Eshetu, E., Awekew, A., & Thomas, N. (2016). A study on the prevalence of bovine mastitis and associated risk factors in and the surrounding areas of sodo Town, Wolaita Zone, Ethiopia. Global Journal of Science FrontierResearch:D. Agriculture and Veterinary, 16(2), 12-19.

https://www.researchgate.net/publication/301895721

7- van Soest FJ, SantmanBerends IM, Lam TJ, HogeveenH. 2016. Failure and preventive costs of mastitis on Dutch dairy farms. J Dairy Sci 99:8365-8374.doi: 10.3168/jds.2015-10561. DOI: 10.3168/jds.2015- 10561

8-Lasagno, M.C.; Reinoso, E.B.; Dieser, S.A.; Calvinho, L.F.; Buzzola, F.; Vissio, C.; Bogni, C. and Odierno, L.M. (2011): Phenotypic and genotypic characterization of Streptococcus uberis isolated from bovine subclinical mastitis in Argentinean dairy farms. Rev. Argent. Microbiol., 43: 212-217.

doi: 10.1590/S0325-75412011000300009

9-Quinn, P.J.; Markey, B.K.; Leonard, F.C.; FitzPatrick, E.S.; Fanning, S. and Hartigan, P.J. (2011):

Veterinary Microbiology and Microbial Disease. 2nd ed., Wiley-Blackwell, J Wiley and Sons Ltd Publication, UK.

10-Jiang, M.; Babiuk, L. and Potter, A. (1996): Cloning, sequencing and expression of the CAMP factor gene of Streptococcus uberis. Microbiol. Path., 20: 297-307.

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC96801/pdf/ii004725.pdf

11-Asfour , H. A., Darwish, S. F., & EL-Wakeel, S. A.2016 phenotypic and genotypic characterization of streptococcus uberis isolated from mastitic coes .. Assiut Vet. Med. J. Vol. 62 No. 151.

DOI: 10.1590/S0325-75412011000300009

12-Kaczorek, E., Małaczewska, J., Wójcik, R., & Siwicki, A. K. (2017). Biofilm production and other virulence factors in Streptococcus spp. isolated from clinical cases of bovine mastitis in Poland. BMC veterinary research, 13(1), 1-7. https://bmcvetres.biomedcentral.com/articles/10.1186/s12917-017- 1322-y

13- Mathur, T.; Singhal, S.; Khan, S.; Upadhyay, D.J.; Fatma, T. and Rattan, A. (2006): Detection of biofilm formation among the clinical isolates of Staphylococci: and evaluation of three different screening methods. Ind. J. Med. Microbiol., 24: 25-29.

14-Shukla,S.K.and Rao,T.S.(2017).Animproved crystal violet assay for biofilm quantification in 96-well microtiter plate.Biorxiv,(1):1-10 . doi: https://doi.org/10.1101/100214

15-Davies, P.L.; Leigh, J.A.; Bradley, A.J.; Archer, S.C.; Emes, R.D. and Green, M.J. (2016): Molecular epidemiology of Streptococcus uberis clinical mastitis in dairy herds: Strain heterogeneity and transmission. J. Clin. Microbiol., 54 (1): 68-74.

16-Ebrahimi, A.; Nikookhah, F.; Nikpour, S.; Majiian, F. and Gholami, M. (2008): Isolation of Streptococci from milk samples of normal, acute and subclinical mastitis cows and determination of their antibiotic susceptibility patterns. Pak. J. Biol. Sci., 11(1):148-50.

17-El-Jakee, J.; Hableel, H.S.; Kandil, M.; Hassan, O.F.; Khairy, E.A. and Marouf, S.A. (2013):

Antibiotic resistance patterns of Streptococcus agalactiae isolated from mastitic cows and ewes in Egypt. Global Veterinaria 10 (3): 264-270.

18-Steele, N.M.; Williamson, J.H.; Laven, R.A. and Hillerton, J.E. (2015): Using polymerase chain reaction to identify Streptococcus uberis in bovine milk: how does it compare with bacterial culture?

Proceedings of the New Zealand Society of Animal Production. 75:20- 23.

19-Teklemariam, A.D.; Nigussie, H.; Tassew, A.; Tesfaye, B.; Feleke, A. and Sisay, T. (2015): Isolation and phenotypic characterization of Streptococcus uberis from mastitic cows in and around Batu town, Ethiopia. J. Animal &Plant Sci., 26 (3): 4124-4137.

20-Costa, J. C. M., de Freitas Espeschit, I., Pieri, F. A., dos Anjos Benjamin, L., & Moreira, M. A. S.

(2012). Increased production of biofilms by Escherichia coli in the presence oenrofloxacin. Veterinary microbiology, 160(3-4), 488-490. DOI: 10.1016/j.vetmic.2012.05.036

21-Adesola, A.E. (2012): Antimicrobial resistance pattern of Streptococci and Staphylococci isolated from cases of bovine clinical mastitis in Nigeria. Nat. Sci., 10 (11): 96-101 DOI: 10.1080/00480169.2013.843135.

22-Almeida, A.; Albuquerque, P.; Araujo, R.; Ribeiro, N. and Tavares, F. (2013): Detection and discrimination of common bovine mastitis causing Streptococci. Vet. Microbiol., 164: 370-377 DOI: 10.1016/j.vetmic.2013.03.011 .

23-Almeida, R.A.; Kerro-Dego, O.; Headrick, S.I.; Lewis, M.J. and Oliver, S.P. (2015b): Role of Streptococcus uberis adhesion molecule in the pathogenesis of Streptococcus uberis mastitis. Vet.

Microbiol., 30;179 (3-4): 332-335. DOI: 10.1016/j.vetmic.2015.07.005

24-Almeida, R.A.; Kerro-Dego, O.; Prado, M.E.; Headrick, S.I.; Lewis, M.J.; Siebert, L.J.; Pighetti, G.M.

and Oliver, S.P. (2015a): Protective effect of anti-SUAM antibodies on Streptococcus uberis mastitis.

Vet. Res., 46:133. https://doi.org/10.1186/s13567-015-0271-3

25-Almeida, R.A.; Luther, D.A.; Park, H.M. and Oliver, S.P. (2006): Identification, isolation, and partial characterization of a novel Streptococcus uberis adhesion molecule (SUAM). Vet. Microbiol., 115:183-191. DOI: 10.1016/j.vetmic.2006.02.005

26-Amosun, E.A.; Ajuwape, A.T.P. and Adetosoye, A.I. (2010): Bovine Streptococcal mastitis in Southwest and Northern States of Nigeria. Afr. J. Biomed. Res., 13(1): 33-37.

27-Arciola, C.R.; Campoccia, D. and Montanaro, L. (2002): Detection of biofilm-forming strains of Staphylococcus epidermidis and S. aureus. Expert Rev. Mol. Diag., 2(5):478-484.

DOI: 10.1586/14737159.2.5.478

28-Chiang, YC.; Pai, WY.; Chen, C.Y. and Tsen, HY. (2008): Use of primers based on the heat shock protein genes hsp 70, hsp 40, and hsp 10, for the detection of bovine mastitis pathogens Streptococcus agalactiae, Streptococcus uberis and Streptococcus bovis. Molecular and Cellula probes. 22: 262-266.

DOI: 10.1016/j.mcp.2008.05.004

29-Hertl, J. A., Schukken, Y. H., Welcome, F. L., Tauer, L. W., & Gröhn, Y. T. (2014). Effects of pathogen-specific clinical mastitis on probability of conception in Holstein dairy cows. Journal of dairy science, 97(11), 6942-6954. https://doi.org/10.3168/jds.2014-8203

30-Katholm, J.; Bennedsgaard, T.W.; Koskinen, M.T. and Rattenborg, E. (2012): Quality of bulk tank milk samples from Danish dairy herds based on real-time polymerase chain reaction identification of mastitis pathogens. J. Dairy Sci., 95(10):5702-5708. DOI: 10.3168/jds.2011-5307

31-Khan, I.U.; Hassan, A.A.; Abdulmawjood, A.; Lämmler, C.; Wolter, W. and Zschöck, M. (2003):

Identification and epidemiological characterization of Streptococcus uberis isolated from bovine mastitis using conventional and molecular methods. J. Vet. Sci., 4(3): 213-223.

https://pubmed.ncbi.nlm.nih.gov/14685025

32-Kia, G.; Mehdi, G. and Keyvan, R. (2014): Prevalence and antibiotic susceptibility of Streptococcus spp. in cows with mastitis in Germi, Iran. Anim. Vet. Sci., 2 (2): 31-35.

DOI: 10.11648/j.avs.20140202.13

33-Kromker, V.; Reinecke, F.; Paduch, J.H. and Grabowski, N. (2014): Bovine Streptococcus uberis intramammary infections and mastitis. Clin. Microbial., 3,4: 1-7. doi:10.4172/2327-5073.1000157 34-Lämmler, C. (1991): Biochemical and serological properties of Streptococcus uberis. J. Vet. Med.,

38:737-742. https://doi.org/10.1111/j.1439-0450.1991.tb00937.

35- Schukken, Y. H., Günther, J., Fitzpatrick, J., Fontaine, M. C., Goetze, L., Holst, O., ... & Smith, D. G.

E. (2011). Host-response patterns of intramammary infections in dairy cows. Veterinary immunology and immunopathology, 144(3-4), 270-289. DOI: 10.1016/j.vetimm.2011.08.022

36-Schukken, Y. H., Günther, J., Fitzpatrick, J., Fontaine, M. C., Goetze, L., Holst, O., ... & Smith, D. G.

E. (2011). Host-response patterns of intramammary infections in dairy cows. Veterinary immunology and immunopathology, 144(3-4), 270-289. doi: 10.1016/j.vetimm.2011.08.022. Epub 2011 Sep 10.

37-Teklemariam, A. D., Nigussie, H., Asmelash Tassew, B. T., & Aklilu Feleke, T. S. (2015). Isolation and phenotypic characterization of Streptococcus uberis from mastitic cows in and around Batu town, Ethiopia. Journal of Animal &Plant Sciences, 26(3), 4124-4137.

https://www.m.elewa.org/JAPS/2015/26.3/3.%20Addisu.pdf

38-Tomazi, T., Gonçalves, J. L., Barreiro, J. R., Arcari, M. A., & Dos Santos, M. V. (2015). Bovine subclinical intramammary infection caused by coagulase-negative staphylococci increases somatic cell count but has no effect on milk yield or composition. Journal of dairy science, 98(5), 3071-3078. doi:

10.3168/jds.2014-8466. Epub 2015 Feb 26