Identification Of Single Nucleotide Polymorphism In Follicle Stimulating Hormone Receptor In Women Undergoing IVF Treatment
Durgadevi Selvaraj1, Shanmathi Rajagopal2, Vidyalakshmi Subramanian*3, Sujatha Suresh4, Silambuselvi D5
1M.Tech, 2M.Tech, 3PhD, 4PhD, 5MBBS, DGO
1,2,3Department of Biotechnology, PSG College of Technology, Coimbatore-641004, India.
4,5Vamsam Fertility Centre, Coimbatore-641006.
Email: , 1[email protected], 2[email protected]., 3[email protected].,
4[email protected], 5[email protected]
Abstract Background
Follicle Stimulating Hormone (FSH) is administered to IVF patients to stimulate ovulation induction.
Upon FSH stimulation, patient response is seen to be variable and unpredictable. One of the most widely studied gene to control ovarian response to FSH stimulation is the levels of expression of FSH Receptor (FSHR). The present study aims to investigate the association between FSHR polymorphisms at position p.Thr307Ala (c.919A>G, rs6165), and follicular development in women undergoing IVF treatment and to determine the correlation between these SNPs and ovarian response.
Materials and Methods
Study group included control (N=27) and study (N=23) samples from patients undergoing IVF treatment. Nested PCR - RFLP was performed to analyze the FSHR gene polymorphism. Chi-square test was used for investigating the association of SNP with follicular development.
Results
The genotype frequency of Ala/Ala (43.50%) was significantly (p<0.05) more prevalent in IVF patients. In individuals with this genotype, the follicular count was significantly (p<0.05) lesser as compared to other genotypes (Thr/Thr (33.30%), Thr/Ala (54.50%), Ala/Ala (90.00%)). It was also seen that 72.7% of the patients having Ala/Ala genotype were poor responders to FSH stimulation protocol, during IVF.
Conclusion
From the analysis it is seen that there is a significant association between the tested FSHR polymorphism and follicular development. This study showed that the Ala/Ala genotype could be used as a good predictor of ovarian response by the clinicians.
Key words: FSHR polymorphisms, RFLP, SNPs, Poor responders.
BACKGROUND
Infertility is the failure to become clinically pregnant after a period of 12 months or more of regular sexual intercourse [1]. Globally 12-15 % of population is affected by infertility due to various genetic and environmental factors [2]. The major reasons for female infertility might be due to improper functioning of ovaries, fallopian tubes and uterus.
In Vitro Fertilization (IVF), an Assisted Reproductive Technology (ART) is widely adopted for the treatment of infertility [3]. The success of IVF treatment depends on various factors like age, growth of follicles, antral follicle count (AFC), basal Follicle Stimulating Hormone (FSH) levels and the quality of the egg which is retrieved for IVF treatment [4].
FSH is one of the pituitary glycoproteins that play an important role during folliculogenesis by triggering the maturation of follicles. It acts through the FSH receptor (FSHR), a member
of the family of G-protein-coupled receptors expressed solely in granulosa cells. FSH plays a pivotal role in the recruitment of the dominant follicle in women and stimulating the follicular growth. It is used for controlled ovarian stimulation during IVF protocol and for other infertility treatments in both females and males [5].
Any mutation in FSH and FSHR genes is an important factor associated with infertility and IVF treatment failure. More than 1300 (Single Nucleotide Polymorphisms) SNPs have been identified in FSHR gene. Various mutations in FSHR gene can cause arrest at the antral or later stages of follicular growth and thereby lead to a diminished ovarian reserve resulting in infertility. Among the various polymorphisms, one at exon 10 [6] at the aminoacid position 307 (c.919A>G, rs6165) prompts codon change from threonine (ACT) to alanine (GCT) [7].
The relationship of an SNP at position 307 (c.919A>G, rs6165) has been outlined with poor ovarian reaction and decreased FSHR articulation [2]. It was previously shown that A/A genotype is related with poor ovarian response [4], [8]. Further, the poor ovarian response was shown to be implicated due to a decrease in the levels of receptor at the transcript and protein levels in granulosa cells [4]. A few parameters, primarily hormones have been proposed as indicators of ovarian response. Among these, day 3 serum FSH level has been shown to be a valid marker for deciding ovarian response upon stimulation protocol in clinical practice [8].
The purpose of this study is to examine the SNP p.Thr307Ala (rs6165) in women undergoing IVF treatment in South Indian population and to find out the frequency distribution of the polymorphism among this population. In addition, the association and correlation between the SNPs (TT, TA& AA), and follicular development and ovarian response of patients were analyzed.
MATERIALS AND METHODS:
SNP analysis for FSHR307 loci of the FSHR gene was performed in 50 Indian women. The study contain controls (n=27) and study (n=23) group from women undergoing treatment at Vamsam Fertility Research Centre, Coimbatore and the study is approved by the IHEC (Institutional human ethics committee), Avinashilingam Institute for Home Science and Higher Education for Women, Coimbatore.
The study group consisted of women who were less than 40 years of age, FSH level below 8UI/l at cycle day 3, antral follicle count greater than 10, and infertility not reported due to tubal factor or male factor were included. Patients with Ovulation anomalies and previous treatment failure due to poor response were excluded. The control group consisted of proven fertile, healthy women, who were normo gonadotropic ovulatory females with infertility reported due to male factor.
Ovulation induction protocol:
Ovulation was induced by following standard protocol. Levels of exogenous FSH were monitored by assessing serum estradiol levels and follicular count.
Genotyping analysis:
2 ml of blood was collected in a vacutainer- lavender top tube from each subject after informed consent from the patients. Genomic DNA was obtained from the peripheral blood by salting out method [9].
PCR-RFLP was performed for SNP p.Thr307Ala (rs6165) using 1X Emerald Amp GT-PCR Master Mix with the following primers (Primer-1: 5’-TCTGAGCTTCATCCAATTTGCA-3’
and Primer-2: 5’- GGAAAGAGGGCAGCTGCAA-3’) [10]. The cycling program for the amplification was as follows: denaturation at 98ºC for 10 sec; annealing at 62 ºC for 30 sec;
elongation at 72ºC for 1min; and final elongation at 72ºC for 7 min. 657 bp size of amplified DNA fragments were visualized in a 1.5% agarose gel.
Nested PCR was performed with the amplified DNA fragment of 657 bp by using 1X Emerald Amp GT-PCR Master Mix with the following primers (Primer-3:
5’CAAATCTATTTTAAGGCAAGAAGTT GATTATATGCCTCAG-3’ Primer-4: 5’- GTAGATTCCAATGCAGAGATCA-3’) [10]. Mismatch nucleotide has been induced in primer 3 (indicated by a line). The cycling program for the amplification of polymorphism was as follows: denaturation at 98ºC for 10 sec; annealing at 56ºC for 30 sec; elongation at 72ºC for 1 min; and final elongation at 72ºC for 7 min. 364 bp size of amplified DNA fragment would visualized in a 1.5% agarose gel. For this polymorphism (p.Thr307Ala), mismatch in primer 4 and A – G transition will create a recognition site for Bsu36I (Eco81I) restriction enzyme. Digestion of PCR product was performed with the respective restriction enzymes at 65ºc for 1-12 hours.
STATISTICAL ANALYSIS:
The data are represented as mean±SD. Statistical analysis was performed using SPSS Statistics version 13.0.Chi-squared analyses were employed to analyze the frequency distribution of polymorphisms across the different groups studied. P<0.05 was used to represent statistical significance.
RESULTS
PCR-RFLP analysis of p.Thr307Ala showed three difference patterns: (i) A fragment of 328bp indicated homozygous Ala/Ala (AA) genotype, (ii) The fragment sizes of 364bp and a 36bp indicated homozygous Thr/Thr (TT) genotype and (iii) Presence of all three fragments (364 bp, 328 bp and 36bp) indicated heterozygous Thr/Ala (TA) genotype. The 36 bp band was not visible.
Allelic frequency of p.Thr307Ala polymorphism in the subjects enrolled under ART program was found to be 43.5%, as against nil in the control samples as shown in Table 1. In the subjects the polymorphism for homozygous TT and heterozygous TA variants was significantly (p<0.001) lower than the control samples.
Table 1 Genotype frequency distribution of FSHR p.Thr307Ala in patient and control groups Samples TT (307Thr/Thr)
Variant
TA (307Thr/Ala) Variant
AA (307Ala/Ala) Variant
Control (N=
27)
44.40% (n=12)a 55.60% (n=15)b Nila,b
Patient (N=23) 26.10% (n=6)c 30.40% (n=7)d 43.50% (n=10)c,d p < 0.001is considered statistically significant.
a. Values significantly different among AA and TT groups b. Values significantly different among AA and TA groups c. Values significantly different among AA and TT groups d. Values significantly different among AA and TA groups
In this study to analyze the potential association between the genotypes of the FSHR variant with follicular development and ovarian response during controlled ovarian stimulation, the clinical parameters were analyzed for the subjects are given in Table 2. The subjects were categorized further based on the genotype obtained for p.Thr307Ala polymorphism.
Table 2 Clinical parameters of patients undergoing IVF treatment, segregated based on p.Thr307Ala polymorphism
Clinical parameters TT (307Thr/Thr) Variant
TA (307Thr/Ala) Variant
AA (307Ala/Ala) Variant
Age 31.00±1.89 28.25±2.68 32.50±1.86
Day 3 FSH Level 5.34±0.81 6.23±1.44 5.33±0.83
Number of Mature
Oocyte 8.40±1.08 17.00±4.70 7.50±1.26
Follicle count 8.94±1.18a 10.54±1.43b 6.55±1.61a,b
Estradiol level on day of HCG/HMG
administration (pg/ml)
3076.28±701.57 4157.13±888.13 3326.9±827.807 Antral follicular count 6.83±0.70c 8.36±1.52d 4.65±0.47c,d Note: values are mean (± SEM). P<0.05 is considered statistically significant.
a. Values significantly different among AA and TT groups b. Values significantly different among AA and TA groups c. Values significantly different among AA and TT groups d. Values significantly different among AA and TA groups
Polymorphism in the FSHR gene may lead to impairment in the follicular development.
Higher count of follicle will increase the IVF success rate. Among the three variants, TA variant is associated with highest follicle count (10.54±1.43) are given in Table 2 but 54.50%
of population were found to have follicular count less than 8.90.0% of population with AA
statistically significant association (P < 0.016) between the follicle counts with SNP of FSHR gene. The above data clearly indicate that the AA variant is associated with poor ovarian response after FSH stimulation.
Table 3 Influence of p.Thr307Ala in follicular development Follicle count TT (307Thr/Thr)
Variant
TA (307Thr/Ala) Variant
AA (307Ala/Ala) Variant Follicle count less than
8
33.30% (n=6)a 54.50% (n=12)b 90.00% (n=9)a,b Follicle count greater
than 8
66.70% (n=12)c 45.50% (n=10)d 10.00% (n=1)c,d p < 0.016 is considered statistically significant.
a. Values significantly different among AA and TT groups b. Values significantly different among AA and TA groups c. Values significantly different among AA and TT groups d. Values significantly different among AA and TA groups
Antral follicle count is the best basal marker available for ovarian reserve in terms of predicting poor response in IVF [11]. Based on the AFC counts, patients were segregated into good responders and poor responders. From Table 4, it was seen that a significantly (P <
0.05) higher AA variants were poor responders.
Table 4 Genotype frequency distribution of FSHR Thr307Ala variant in good responder and poor responder
Responders TT (307Thr/Thr) Variant
TA (307Thr/Ala) Variant
AA (307Ala/Ala) Variant Good
responder
41.70% (n=5)a 41.70% (n=5)b 16.70% (n=1)a,b Poor
responder
9.10% (n=1)c 18.20% (n=2)d 72.70% (n=8)c,d P < 0.023 is considered statistically significant.
a. Values significantly different among AA and TT groups b. Values significantly different among AA and TA groups c. Values significantly different among AA and TT groups d. Values significantly different among AA and TA groups DISCUSSION
The distribution of several allelic variants of the FSHR gene has been described in different populations. Many studies have attempted to find out the association between the frequency distribution of FSHR polymorphism and ovarian response. Our data also revealed a statistically significant difference among patients and controls with respect to their clinical parameters.
Studies focused on SNP (A/A genotype) in promoter region of FSHR gene at position –29 was correlated with poor ovarian responses to FSH in IVF treatment in various populations [2], [3]. According to our study, poor ovarian response is defined as the low number of production of collectable oocytes (ranging from <3 to <6) despite the use of appropriate FSH dosage. Another study has also demonstrated that FSHR 307Ala/Ala allele was associated with poor response to FSH in a Polish population [12].
Thr307Ala substitution located in the extracellular domain of FSHR might change the function of ligand-receptor interaction. SNP at position - 29 of FSHR quality may impact availability of FSHR to FSH in vivo resulting in poor ovarian response. Hence, these subjects would require higher dosage of exogenous FSH for ovulation induction during IVF process.
Another study revealed that even if FSH is exogenously administrated to women experiencing IVF leads lowered recovery of developed oocytes [13].The present study showed that, there is a significant (p<0.05) association between patient response (follicular development) and AA (307Ala/Ala) variant. Defects in FSHR gene might diminish the ability of the receptor to bind to FSH, leading to lower follicle development and ovarian dysfunction resulting in repeated failures upon IVF treatments.
The impact of FSHR polymorphisms on infertility, needs to be further examined at molecular level in various population groups. To confirm the present outcome, a larger south Indian cohort needs to be analyzed.
List of abbreviations
ART Assisted Reproduction Techniques AFC Antral follicle count
FSH Follicle Stimulating Hormone
FSHR Follicle Stimulating Hormone Receptor IHEC Institutional human ethics committee IVF In-Vitro Fertilization
SNP Single Nucleotide Polymorphisms
Declaration The authors declare that this research has not been published or submitted elsewhere for publication.
Ethical approval and consent to participate
The study is approved by the IHEC (Institutional human ethics committee), Avinashilingam Institute for Home Science and Higher Education for Women, Coimbatore.
Consent for publication: A written consent form was obtained from all the participants.
Availability of data and materials: Raw data is available with the corresponding author and can be submitted upon request.
Competing interest: None Funding: Self
Author's contributions: DS and SR collected samples, performed analyses, compiled results and written the manuscript.
SD and SS monitored the clinical sample collection and helped in data analyses.
SV conceived the work, analyzed the results, written and corrected the manuscript.
The authors are grateful to PSG management for funding this work.
REFERENCES
[1]. Zegers-Hochschild F, Adamson GD, Dyer S, Racowsky C, de Mouzon J, Sokol R, et al (2017) The international glossary on infertility and fertility care. Human reproduction 32(9):1786-801.
[2]. Bonyadi K, Damavandi E, Choobineh H, Kabuli M, Agha-Hosseini M, Ghadami M (2017) Association of FSH receptor promoter’s polymorphisms with IVF-failure in Iranian women. Int J ReprodContraceptObstet Gynecol 6(9):3760-4.
[3]. Boudjenah R, Molina-Gomes D, Torre A, Bergere M, Bailly M, Boitrelle F, et al (2012) Genetic polymorphisms influence the ovarian response to rFSH stimulation in patients undergoing in vitro fertilization programs with ICSI. PLoS One 7(6):e38700.
[4]. Desai SS, Roy BS, Mahale SD (2013) Mutations and polymorphisms in FSH receptor functional implications in human reproduction. Reproduction 146(6):R235-48.
[5]. Lussiana C, Guani B, Mari C, Restagno G, Massobrio M, Revelli A (2008) Mutations and polymorphisms of the FSH receptor (FSHR) gene: clinical implications in female fecundity and molecular biology of FSHR protein and gene. Obstetrical &
gynecological survey 63(12):785-95.
[6]. Livshyts G, Podlesnaja S, Kravchenko S, Sudoma I, Livshits L (2009) A distribution of two SNPs in exon 10 of the FSHR gene among the women with a diminished ovarian reserve in Ukraine. Journal of assisted reproduction and genetics 26(1):29.
[7]. Aittomaki K, Lucena JD, Pakarinen P, Sistonen P, Tapanainen J, Gromoll J, et al (1995) Mutation in the follicle-stimulating hormone receptor gene causes hereditary hypergonadotropic ovarian failure. Cell 82(6):959-68.
[8]. Achrekar SK, Modi DN, Desai SK, Mangoli VS, Mangoli RV, Mahale SD (2009) Poor ovarian response to gonadotrophin stimulation is associated with FSH receptor polymorphism. Reproductive biomedicine online 18(4):509-15.
[9]. Miller SA, Dykes DD, Polesky HF (1988) A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic acids research 16(3):1215.
[10]. Sudo S, Kudo M, Wada SI, Sato O, Hsueh AJ, Fujimoto S (2002) Genetic and functional analyses of polymorphisms in the human FSH receptor gene. Molecular human reproduction 8(10):893-9.
[11]. Bancsi LF, Broekmans FJ, Eijkemans MJ, de Jong FH, Habbema JD, teVelde ER (2002) Predictors of poor ovarian response in in vitro fertilization: a prospective study comparing basal markers of ovarian reserve. Fertility and sterility 77(2):328-36.
[12]. Rod A, Jarzabek K, Wolczynski S, Benhaim A, Reznik Y, Denoual-Ziad C (2014) ESR1 and FSHR gene polymorphisms influence ovarian response to FSH in poor responder women with normal FSH levels. EndocrinolMetab Synd 3(141):2161-1017.
[13]. Kailasam C, Keay SD, Wilson P, Ford WC, Jenkins JM (2004) Defining poor ovarian response during IVF cycles, in women aged< 40 years, and its relationship with treatment outcome. Human Reproduction 19(7):1544-7.
