Association of IFN-α Receptor Promoter (IFNAR1) Gene Polymorphism with Multiple Sclerosis in Iraqi Patients
Entedhar Kadhem Hameed1, Anwar A. Abdulla2*
1,2Department of Biology, College of Sciences, Babylon University, Iraq
* Corresponding author: [email protected]
ABSTRACT
Seventy Multiple sclerosis (MS) patients and fifty apparently healthy as a control group. The result of current study showed the mean serum level of IFNAR1 was higher decreased significantly (P ≤ 0.01) than in controls (791.6131 ± 544.066 pg/ml vs. 1352.995 ± 491.2842 pg/ml) respectively. Blood samples were used to extract DNA. Detection of genotypes IFNAR1 18417 were performs by RFLP-PCR. The distribution of the observed IFNAR SNP 18417 genotype and alleles frequencies in the case group heterozygous CG genotype frequency was highly significantly increased in patients compared to controls (52.9%) and (14%) respectively; OR = 0.1892; CI (95) = 0.0760 - 0.4708). The genotype of (GG) was highly significantly decreased in patients compared with control (45.7% vs. 82%);
respectively; OR = 5.409; CI (95) = (2.2864 - 12.7996). The present study shows that the presence of IFNAR1were significantly associated with genotype of IFNAR1 (18417) (GG, CG, CC) among patients and control at (P ≤ 0.05). The present results showed the CC and GG genotypes of IFNAR1 (18417) gene were revealed that the risk of MS among cases than control. It’s possible that this has a predisposing impact on the development of MS.
KEY WORD: Multiple Sclerosis, IFNAR1, RFLP-PCR, SNP, Polymorphism
Introduction
Multiple sclerosis (MS) is a neurodegenerative autoimmune disease characterized by axon demyelination and that causes communication problems of the human nervous system [1,2].The immunopathogenesis of MS is initiated by a breakdown of the blood-brain barrier (BBB), activation of macrophages, secretion of interferon-gamma (IFN-), and trafficking of myelin-basic protein (MBP) autoreactive T-cells from peripheral blood to the central nervous system (CNS), in which cytokines play a significant role [3,4].Genetic and environmental factors have been reported to contribute to MS progression, [5].Single nucleotide polymorphisms (SNPs) in cytokine genes have been shown to affect serum levels of cytokines that are positively or negatively correlated with various diseases, including autoimmune diseases [6,7]. The aim of the present study is to investigate the association of polymorphisms of IFNAR1gene with the susceptibility of Multiple sclerosis Iraqi patients.
Material nnd Methods Study Subjects
The research has been carried out between February 2020 to April, 2021.Seventy (26 male and 44 female) Iraqi patients relapsing with relapsing – remitting multiple sclerosis (RRMS), administrated immunotherapy (IFN-β), enrolled in this study. The patients were included at the
multiple sclerosis unit of Baghdad Teaching Hospital's consulting clinic in Baghdad's medicine city, Imam AL-Husseni Teaching Hospital in Karbala and Imam AL Sadiq Hospital in Babylon.
The patients were clinically diagnosed, according to the revised McDonald criteria of 2010 [8], which was based on a clinical examination, magnetic resonance image (MRI), immunological tests. The age of the case ranges from (14-59) years old. Whereas, the control group including 50 persons (21 male and 29 female) apparently healthy.
Determination of serum IFNAR1
Human IFNAR1 level was measured in sera of MS patients and controls using the specific kit (ELISA) supplied by Bioassay Technology Laboratory / China. The samples concentrations calculated by a standard curve fitting equation that performed for IFNAR1, (Figure 1).
Figure 1. Standard curve of IFNAR1.
Extraction of Genomic DNA
Genomic DNA of frozen whole blood of both patients and control groups were extracted using gSYNC™ DNA Extraction Kit (Gene aid /Taiwan). The absorbance was used for the assessment of the quantity and purity of DNA at 260 nm/280 nm and the pure DNA had an optical density ratio of less than 1.8.
Genotype of IFNAR1 18417 Polymorphism
Two primers were selected (F-5’- AGAAGTACATTTAGAAGCTG -3) and (R- 5’ - CAATCCTTTCCTATAACACAA -3’) (Macrogen /Korea) [9] to amplify a fragment of 261 bp for alleles detection, aliquots of amplified DNA products were digested with Ddeɪ (New England Biolabs). The PCR conditions were 95°C for 2 min, amplifications were carried out in a GTC thermal cycler (Cleaver Scientific, UK). for 35 cycles, each with 40 s denaturation at 95°C, 40 s annealing at 52 ˚C and 60 s extension at 72 ˚C. The final elongation step at 72 ˚C was for 2 min.
The PCR product IFNAR 18417 promoter gene was digested with restriction endonucleases in a total volume of 25μl containing 10 units of enzyme with buffers supplied by the manufacturer’s
instructions. The PCR products have been checked on 2% (w/v) of agarose gel for expected size [10].
Biostatistical Analysis
The SAS (2012)[11] program of the Statistical Analysis System detected differences in the analysis parameters. Chi-square tests were used to compare the percentage significantly (0.05 and 0.01 probability).
Results and Discussion
The present study demonstrated that the age groups range from (11-60) years old and they were divided into five groups, involved (11-20), (21-30), (31-40), (41-50) and (51-60) years, It was found that significantly frequent patients with multiple sclerosis in the age range from (31-40) years (0.039) at (P ≤ 0.05), table (1).Several previous studies achieved in Iraq by Al-Fahad and Dauod (1994)[12]; Al-Shamssie (2001)[13] and Al-Araji and Mohammed (2005)[14] they reported that MS mainly affects the middle age group. As well as from other countries [15,16].The distribution of the patients according to the age at onset (onset of symptoms), EDSS and duration of the disease as shown in table (2).The current study reported that high significantly frequent cases with multiple sclerosis in the age at onset range from (21-30) year.
Mean age ± standard deviation of cases was (28.04 ± 2.38) years old, (P ≤ 0.01). Additionally, the duration of disease and EDSS that high significantly frequent cases with multiple sclerosis compare with control, table (2). Eight functional systems (FS) measure disability: pyramid, cerebellar, brain stem, sensory, bowel, visual, cerebral and other systems disabled [17].
Table 1. Age distribution among controls and multiple sclerosis patients Age
(years)
Control N (Mean ± SD)
Patients N (Mean ± SD)
Total N (Mean ± SD)
P value 11 – 20 0 (0 ± 0) 3 (17 ± 3.0) 3 (17 ± 3.0) 0.083 21 – 30 16 (27.06 ± 2.64) 10 (25.9 ± 2.33) 26 (26.61 ± 2.54) 0.293 31 – 40 16 (35 ± 2.82) 30 (34.93 ± 3.16) 46 (34.95 ± 3.01) 0.039 * 41 – 50 16 (45.56 ± 2.86) 26 (45.57 ± 3.23) 42 (45.57 ± 3.06) 0.122 51 – 60 2 (55.5 ± 0.707) 1 (59 ± 0.00) 3 (56.66 ± 2.08) 0.563 Total 50 (36.66 ± 8.85) 70 (37.17 ± 8.98) 120 (36.95 ± 8.90) 0.067 P value 0.00002 * 0.00001 * 0.00001 *
* means significance differences (P ≤ 0.05).
Table 2. Distribution of the patients according to the age at onset of the disease Age at Onset (years) N (Mean ± SD) P value
11 – 20 9 (17.5 ± 1.94)
0.0000 **
21 – 30 22 (28.04 ± 2.38) 31 – 40 21 (35.66 ± 3.02) 41 – 50 18 (44.77 ± 2.57) Total 70 (33.28 ± 9.14)
Disease Duration(years) N (%) P value
≤ 5 54 (77.14 %)
0.00001 **
5 –> 10 16 (22.85 %)
Total 70 (100 %)
Mean ± SD 4.2 ± 3.786
EDSS N (%) P value
≤ 3 61 (87.14)
0.001**
> 3 9 (12.85)
Total 70 (100 %)
** means significance differences (P ≤ 0.01).
Estimation of serum IFNAR1
The result of this study showed in multiple sclerosis patients, the mean serum level of IFNAR1 was higher decreased significantly (P ≤ 0.01) than in controls (791.6131 ± 544.066 pg/ml vs.
1352.995 ± 491.2842 pg/ml) respectively., table (3).Cytokines play a significant role in the regulation of cytokines in Several linked immune and non-immune systems. In addition, some cytokines have important roles in the induction, initiation, development and attenuation of a disease variety [18,19]. Couturier et al., (2011)[20] and Dendrou et al., (2016)[21] They reported that given the therapeutic use of IFN-β in MS, the association of decreased type IFNAR
activation in B cells and T cells carrying the MS-protective class I alleles may at first sound counter-intuitive.
Table 3. Serum level mean of IFNAR1 in multiple sclerosis cases and controls.
Control (N=50) (Mean ± SD)
Patients (N=70)
(Mean ± SD) P value IFNAR1
(pg/ml)
1352.995 ±
491.2842 791.6131 ± 544.066 0.0000 **
** means high significance differences (P ≤ 0.01)
Isolation of Genomic DNA
The blood samples have been used to extract genomic DNA. The high purity sample concentrations of DNA ranged from 1,7 – 1,8 were approximately 87-211 ng/μL, figure (1).
Genotype of IFNAR SNP 18417 Polymorphism
Analysis of IFNAR SNP 18417 Polymorphism by RFLP-PCR Analysis
The genetic polymorphisms of IFNAR 18417SNP was determined using specific primers. The results indicated that molecular size of IFNAR1 18417 was approximately 261bp in length as demonstrated for both MS patients and healthy controls, Figure (2).Detection of the IFNAR1 (18417) SNP polymorphism PCR-RFLP was achieved by a specific restriction enzyme Ddeɪ for digestion of PCR product of IFNAR1 (18417) SNP,figure (3).The results of present study of IFNAR1 (18417) show GG wild homozygous have one band homogenous expected to be 261 bp, the second genotype was CG heterozygous which have 261 bp+155 bp+106 bp bands. While the third group CC heterozygous exhibited two bands 155bp+106 bp fig (3).
Distribution of Genotype and Allele Frequency of the IFNAR1 SNP 18417
The distribution of the observed IFNAR1 SNP 18417 genotype and alleles frequencies in the case group heterozygous CG genotype frequency was highly significantly increased in patients compared to controls (52.9%) and (14%) respectively; OR = 0.1892; CI (95) = 0.0760 - 0.4708).
The genotype of (GG) was highly significantly decreased in patients compared with control (45.7% vs. 82%); respectively; OR = 5.409; CI (95) = (2.2864 - 12.7996), table (6).Leyva et al., (2005)[22] were found significant differences on IFNAR1 18417 genotype and allele frequencies in patients and controls. While, Karam et al., (2016)[9] found reported that the IFNRA1 18417 polymorphism, the frequency of C/C genotype and allele in MS patients was significantly increased comparison with the control group.
Association between Genotypes of IFNAR1 (18417) and serum IFNAR1Levels
The association between IFNAR1 (18417) genotype and IFNAR1, in MS patients and control were investigated. The present study shows that the presence of IFNAR1were significantly
associated with genotype of IFNAR1 (18417) (GG, CG, CC) among patients and control at (P ≤ 0.05). table (7).
Before IFNβ therapy, MS NRs had higher serum IFNβ levels and higher IFN-regulated expression [23,24].. Vandenbroeck and Comabella, (2010)[25] reported that some evidence showed there was some evidence to support the identification of the individual response of MS to IFNβ by polymorphisms IFNAR1 and/or IFNAR2.The genotype IFNA1 18417 C/C was 5 times more likely to have MS than carry the G allele. The genotype IFNAR2 11876 G/G was more than a 2-fold risk than the carrying of the T allele [22].
Figure 1. Gel electrophoresis for DNA human blood samples on 1% agarose gel at 70 volts for 1 hour.
Figure 2.PCR product of IFNAR1 gene (18417) 261bp on 2% agarose gel at 70V for 60min. Lane M: 100 bp DNA marker. Lane (1-13): case. Lane (14-18) control.
Figure 3. RFLP-PCR product with digestion enzyme Ddeɪ for IFNAR1 18417) on 2.5 agarose at 70V for 2hrs.Lane M: 50bp DNA marker. Lane C uncut 261bp.
Lane (1-10): case. Lane (11-17): control. Lane (1,7,9,10,11,12,14,16) three bands 261bp+155bp+106 bp(heterozygous). Lane (2,3,4,5,6,8, 13,15,17,18): two bands 155bp+106 bp.
Table 6. Genotypes and allele frequencies of IFNAR1 (18417) in MS patients and control groups.
Genotype of IFNAR1 (18417)
Control No. (%)
Patients No. (%)
Significanc e level
O. R CI (95%)
GG 41 (82%) 32 (45.7%) 0.0001 ** 5.4097 2.286 - 12.799 CG 7 (14%) 37 (52.9%) 0.0003 ** 0.1892 0.076 - 0.470 CC 2 (4%) 1 (1.4%) 0.3941 2.8750 0.253 - 32.611
Total No. 50 70 - - -
Allele Frequency Frequency - - -
G 0.89 0.72 - - -
C 0.11 0.28 - - -
Table 7. Association between Genotype of IFNAR (18417) and concentration of IFNAR in MS patients and controls
Group Genotype of IFNAR (18417)
Mean ± SD IFNAR1(18417)
Patients
GG 941.8033 ± 599.1912 ab CG 640.0422 ± 437.8482 b CC 1743.838 ± 0.00 a
P value 0.0134
LSD 1065.2195
Control
GG 1399.719 ± 437.6089
CG 1284.162 ± 711.7225
CC 858.6405 ± 511.2163
P value 0.2815
LSD NS
* (P<0.05), NS: Non-Significant Conclusion
The present results showed the CC and GG genotypes of IFNAR1 (18417) gene were revealed that the risk of MS among cases than control. It’s possible that this has a predisposing impact on the development of MS.
References
[1] Fukaura, H.(2014). Environmental risk factors and gene-environment interactions for the development of multiple sclerosis. International Journal of Neurology andNeurotherapy, 1(1), 1–3. doi:10.23937/2378-3001/1/1/1007
[2] Patsopoulos, N. A. (2018). Genetics of multiple sclerosis: An overview and new directions.
Cold Spring Harbor Perspectives in Medicine, 8(7), a028951.
doi:10.1101/cshperspect.a028951
[3] Hernández-Pedro, N. Y., Espinosa-Ramirez, G., de la Cruz, V. P., Pineda, B., & Sotelo, J.
(2013). Initial immunopathogenesis of multiple sclerosis: Innate immune response. Clinical and Developmental Immunology, 2013, 413465. doi:10.1155/2013/413465.
[4] Constantinescu, C. S., & Gran, B. (2014). The Essential Role of T cells in Multiple Sclerosis:
A Reappraisal. Biomedical Journal, 37(2), 34–40. doi:10.4103/2319-4170.128746
[5] Giarola, B., Massey, J., Barnett, Y., Rodrigues, M., & Sutton, I. (2019). Autoimmune encephalitis following alemtuzumab treatment of multiple sclerosis. Multiple Sclerosis and Related Disorders Feb, 28, 31–33. doi:10.1016/j.msard.2018.12.004
[6] Guarnizo-Zuccardi, P., Lopez, Y., Giraldo, M., Garcia, N., Rodriguez, L., Ramirez, L., . . . Vasquez, G. (2007). Cytokine gene polymorphisms in Colombian patients with systemic lupus erythematosus. Tissue Antigens, 70(5), 376–382. doi:10.1111/j.1399- 0039.2007.00917.x
[7] Vandenbroeck, K. (2012). Cytokine gene polymorphisms and human autoimmune disease in the era of genome-wide association studies. Journal of Interferon and Cytokine Research, 32(4), 139–151. doi:10.1089/jir.2011.0103
[8] Milo, R., & Miller, A. (2014). Revised diagnostic criteria of multiple sclerosis. Autoimmunity Reviews, 13(4–5), 518–524. doi:10.1016/j.autrev.2014.01.012
[9] Karam, R. A., Rezk, N. A., Amer, M. M., & Fathy, H. A. (2016). Immune response genes receptors expression and polymorphisms in relation to multiple sclerosis susceptibility and response to INF-β therapy. IUBMB Life. Egypt: Biochemistry Department, Faculty of Medicine, Zagazig University, 68(9), 727–734,2Neurology Department.
doi:10.1002/iub.1530
[10] Sambrook, J., & Russell, D. (2001). Molecular cloning: A laboratory Manual 3rd. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press.
[11] SAS. (2012). Statistical analysis system, User’s guide. Statistical. version 9.1th SAS (Ed.).
Inst. Inc. Cary. NC.
[12] Al-Fahad, S., & Dauod, H. A. (1994). Behavior of multiple sclerosis in Iraq. Iraqi Medical Journal, 43–45, 88–97.
[13] Al-Shamssie, A. F. (2001). Brain MRI findings in multiple sclerosis. A Thesis submitted to the Iraqi Committee for Medical Specialization in partial fulfillment for the degree of fellowship in Radiodiagnosis.
[14] Al-Araji, A., & Mohammed, A. I. (2005). Multiple sclerosis in Iraq: Does it have the same features encountered in Western countries? Journal of the Neurological Sciences, 234(1–2), 67–71. doi:10.1016/j.jns.2005.03.033
[15] Trojano, M., Lucchese, G., Graziano, G., Taylor, B. V., Simpson, S., . . . MSBase Study Group and the New Zealand MS Prevalence Study Group. (2012). Geographical variations in sex ratio trends over time in multiple sclerosis. PLOS ONE, 7(10), e48078.
doi:10.1371/journal.pone.0048078. (Internet. 21/8/2013).
[16] Kampman, M. T., Aarseth, J. H., Grytten, N., Benjaminsen, E., Celius, E. G., Dahl, O. P., . . . Torkildsen, O. (2013). Sex ratio of multiple sclerosis in persons born from 1930 to 1979 and its relation to latitude in Norway. Journal of Neurology, 260(6), 1481–1488.
doi:10.1007/s00415-012-6814-x
[17] Kurtzke, J. F. (1983). Rating neurologic impairment in multiple sclerosis: An expanded disability status scale (EDSS). Neurology, 33(11), 1444–1452. doi:10.1212/wnl.33.11.1444 [18] Ghajarzadeh, M., Jalilian, R., Eskandari, G., Sahraian, M. A., Azimi, A., & Mohammadifar,
M. (2013). Fatigue in multiple sclerosis: Relationship with disease duration, physical disability, disease pattern, age and sex. Acta Neurologica Belgica, 113(4), 411–414.
doi:10.1007/s13760-013-0198-2
[19] Tangye, S. G. (2015). Advances in IL-21 biology—Enhancing our understanding of human disease. Current Opinion in Immunology, 34, 107–115. doi:10.1016/j.coi.2015.02.010 [20] Couturier, N., Bucciarelli, F., Nurtdinov, R. N., Debouverie, M., Lebrun-Frenay, C., Defer,
G., . . . Brassat, D. (2011). Tyrosine kinase 2 variant influences T lymphocyte polarization and multiple sclerosis susceptibility. Brain, 134(3), 693–703. doi:10.1093/brain/awr010 [21] Dendrou, C. A., Cortes, A., Shipman, L., Evans, H. G., Attfield, K. E., Jostins, L., . . .
Fugger, L. (2016). Resolving TYK2 locus genotype-to-phenotype differences in autoimmunity. Science Translational Medicine, 8(363), 363ra149.
doi:10.1126/scitranslmed.aag1974
[22] Leyva, L., Fernández, O., Fedetz, M., Blanco, E., Fernández, V. E., Oliver, B., . . . Matesanz, F. (2005). IFNAR1 and IFNAR2 polymorphisms confer susceptibility to multiple sclerosis but not to interferon-beta treatment response. Journal of Neuroimmunology, 163(1–2), 165–
171. doi:10.1016/j.jneuroim.2005.02.010
[23] Comabella, M., Lünemann, J. D., Río, J., Sánchez, A., López, C., Julià, E., . . . Martin, R.
(2009). A type I interferon signature in monocytes is associated with poor response to interferon-β in multiple sclerosis. Brain, 132(12), 3353–3365. doi:10.1093/brain/awp228 [24] Axtell, R. C., De Jong, B. A., Boniface, K., van der Voort, L. F., Bhat, R., De Sarno, P., . . .
Raman, C. (2010). T helper type 1 and 17 cells determine efficacy of interferon-beta in multiple sclerosis and experimental encephalomyelitis. Nature Medicine, 16(4), 406–412.
doi:10.1038/nm.2110
[25] Vandenbroeck, K., & Comabella, M. (2010). Single-nucleotide polymorphisms in response to interferon-beta therapy in multiple sclerosis. Journal of Interferon and Cytokine Research, 30(10), 727–732. doi:10.1089/jir.2010.0085
