View of The genetic and histological effect of chitosan and selenium nanoparticles in eliminating the side effects of soft drink consumption

http://annalsofrscb.ro 17044

The genetic and histological effect of chitosan and selenium nanoparticles in eliminating the side effects of soft drink consumption

Safaa A. El-Shazly¹, Tarek M.M.Al-Akra², Noha A. Sukar^1* and Amina M.G. Zedan¹

1Biological and Environmental Sciences Dept. Faculty of Home Economics, Al-Azhar University

2 Agric. Zoology and Nematology Dept. Faculty of Agric., Al-Azhar University

*Corresponding author; Noha A. Sukar, E-mail: [email protected], [email protected]

ABSTRACT

Background: Carbonated beverages are the second most-consumed drink in the world. These drinks are already known for their bad effects on bone, teeth, liver, and heart vessels. Soft drinks (SD) are carbonated beverages that are non-alcoholic. There is no study about how we can decrease the SD side effects. Materials and Methods: Sixty-six albino rats (male ) were divided into eleven groups (6 rats/ group). 1: normal control, 2: The animals are treated with Coca-Cola (10ml/kg), 3: The animals were given Coca-Cola and chitosan (200mg/kg), 4: The animals were given Coca-Cola with nano chitosan (500mg/kg), 5: The animals were given Coca-Cola with selenium (0.5mg/kg), 6: The animals were given Coca-Cola with nano selenium (0.5mg/kg), 7: The animals were given 7-Up (10ml/kg); 8: The animals were given 7-Up (10ml/kg) and chitosan(200mg/kg), 9: The animals were given 7-Up and nano chitosan(500 mg/kg), 10: The animals were given 7-Up and selenium (0.5mg/kg), 11: The animals were given 7-Up and nano selenium (0.5mg/kg). All treatments were administered orally by stomach tube. At the end of the research, the following parameters were assessed in each group: body and organ weights, the function of the liver, level of cholesterol, triglyceride, HDL and Rbs, the relative gene expression for Cyp2E1, CAT, and GST1 by real-time PCR and histological studies on liver tissue. Results: The results revealed that treatment with Coca-Cola and 7-up showed an increase in the body weight and liver and spleen weight change after consumption SD. There is a significant increase in liver function parameters, accompanied by changes in the histological section of liver tissues, which also increase the level of cholesterol, triglyceride, and Rbs. The obtained qPCR results showed significant downregulation in the expression levels of Cyp2E1 and CAT genes About GST1, the results showed that both Coca-Cola and 7up have different effects on GST1 gene expression. As for 7up(G7), it worked in increasing the gene expression level compared to the negative control (G1), while Coca-Cola (G2), reduced the gene expression level compared with the negative control(G1). And for the first one, both chitosan, nano chitosan, selenium, and nano selenium succeeded to prevent or at least diminish the toxic effects and the histological changes in the liver. The materials in the form of nano were active in the most of measurements especially gene expression about the native materials.

Conclusion: Many reports indicated the side effect of soft drinks on liver function and gene expression in rat.

This study focus on the substances that alleviate the harmful effect of soft drinks. Nanomaterial of chitosan and selenium have the significant effect in eliminate the Genetical and histological change induced by soft drinks.

Key words: Soft drink, Selenium nanoparticles, Chitosan nanoparticles, Histological Analysis, Gene expression.

INTRODUCTION

Currently, carbonated soft beverage are the most well-known kinds of beverage worldwide and many people drink them daily^1,2. Numerous various health problems are associated with regular intake of soft drink. Soft drinks (SD) contain mainly water, caffeine, phosphoric acid, sugar (sucrose), preservatives, flavors, and colorings³. There is a connection between SD and the incidence of various diseases including dental/bone problems, obesity, cardiovascular disease, and diabetes mellitus^4,5. Caffeine is intentionally added in SD to make persons addicted, and compared to every other drink, it is absorbed rapidly⁶. Corn syrup with a high content of fructose is the major ingredient in SD, mainly because of its sweet taste, low cost, and wide availability. SD potential role in obesity has been suggested⁷. A new meta-analysis reported a clear association between SD consumption and increased energy intake, and previous reviews have concluded that a strong association exists between sweetened SD consumption and the hazard of overweight/obesity^8,9. Harmful histopathological alterations were mentioned mainly in the liver and bone of the Pepsi and Coca-Cola groups. Besides,

http://annalsofrscb.ro 17045

with SD consumption, extreme caution is needed due to the rise in the biomarkers of oxidative stress and a change in the expression of genes that belong to the bio‑vital role of both the kidney and liver¹⁰.

The liver is a main organ which is responsible for several important functions in the body. If it becomes injured or diseased, the failure of liver functions lead to significant injure to the body¹¹. Many researcher have earlier reported that antioxidants inhibit hepatotoxicity by preventing lipid peroxidation¹² also, by suppressing the activity of ALT and AST¹³.

Chitosan is a natural polycationic linear polysaccharide resulting from chitin. Chitosan is a biomaterial that can be used for a alot of purposes because of its low allergenicity, non- toxicity, biodegradability, and biocompatibility¹⁴. Chitosan has been extensively used for different biological and biomedical applications recently due to its rare biological properties.

The chitosan-biological properties such as antitumor¹⁵, antimicrobial¹⁶, and antioxidant activities¹⁷. Selenium (Se) is integrated into selenoproteins which have an extensive variety of pleiotropic role, ranging from anti-inflammatory and antioxidant effects to the creation of active thyroid hormone. Small selenium grade has been belonged to an increased in mortality, cognitive decline, and low immune function. A higher selenium ratio has antiviral properties, also it is a vital role for successful reproduction in male and female, and reduces the threat of autoimmune thyroid disorder¹⁸. The material in the form of nanoparticles enhance bioactivity, improve targeting, reduce toxicity¹⁹. Nanoparticles are divided to inorganic and organic nanoparticles. Because of their ability to endure harsh processing conditions, inorganic nanoparticles have become increasingly important. Biopolymeric nanoparticles have added advantages, like availability from marine resources (chitin and chitosan), biocompatibility, biodegradability, and nontoxicity²⁰. Researchers have confirmed the increased effectiveness of absorption for nano minerals resulting in their elevated bioavailability in contrast to coarse minerals²¹.

Chitosan nanoparticles show excellent activities compared to normal chitosan to promote the immune-enhancing effect, the antimicrobial and the anticancer action^{22, 23}. Chitosan nanoparticles have the action of nanoparticles and the character of chitosan for instance interface effect, and surface, quantum size, and small size effects²⁴. Selenium has a limited therapeutic effect and narrow toxicity margins, whereas Se nanoparticles (SeNps) have significantly lower toxicity. SeNps have been studied in numerous oxidative stress and inflammation-related diseases, including arthritis, diabetes, cancer, and nephropathy, and have shown to have therapeutic potential. SeNps are an appealing carrier vehicle for transporting different drugs to the action site¹⁹.

The current study aimed to examine the effects of SD consumption on body and organ weight, some biochemical alterations, gene biomarkers, and histopathology of the liver, also the novelty of this paper is evaluating some natural and nanomaterials against the damage caused by soft drinks.

MATERIALS AND METHODS

Coca-Cola and 7up doses:

Coca-Cola and 7up beverages were purchased from a local supermarket and were orally administered to rats at a daily dose of 10 ml/ Kg/day for six weeks²⁵.

Chitosan and nano chitosan

Chitosan (C6H11NO4)n with molecular weight 100000-300000 was obtained from Cornell Lap Company, Egypt. For preparing chitosan nanoparticles; 0.1gm of chitosan was dissolved in 100ml of 1% acetic acid solution. The chitosan solution was subjected to magnetic stirring for one hour. Trisodiumpolyphosphate solution (0.25% w/v) were added to the solution of

http://annalsofrscb.ro 17046

chitosan (20:100 respectively) drop by drop under magnetic stirring. Nanoparticles were collected by centrifugation at 6000 rpm for thirty min. at 4°C; the pellets were taken and freeze-dried before further use or analysis²⁶. Particle size was measured by X-ray diffraction analysis technique (Fig 1). The size of chitosan nanoparticles was 122.8 nm.

Fig. ( 1 ). Crystallographic structure of the chitosan nanoparticles size

Selenium (Se) and Selenium Nanoparticles (SeNps)

Selenium was obtained from Sigma Aldresh, Merck, Germany, and used as sodium selenite (Na2SeO3). Ascorbic acid was obtained from Sisco Research Lab pvt ltd, India. For preparing Se nanoparticles; stock solutions of Na2SeO3(100mM) and Ascorbic acid (50mM) were prepared. Ascorbic acid drops were added to the Na2SeO3 solution, which was magnetically stirred for thirty minutes at 1000 rpm RPM (Na2SeO3 to ascorbic acid ratio was 1:3 respectively). The mixtures were given time to react in the concentrated form until the color change from colorless to light orange. Soon after the color transform was noticed the mixture was diluted to 25ml with double distilled water²⁷. The prepared particles were characterized using TEM (Fig 2 ).

http://annalsofrscb.ro 17047

Fig. (2). Transmission electron image (TEM) of selenium nanoparticles.

Animals

The present study was conducted on 66 male Albino rats with an approximate weight of 85±5 gm. They were obtained from the unit of animal care of Vacsera Pharmaceutical Company, Agouza, Egypt. Animals were handled in the unit of experimental animal, Faculty of Home Economics, Al Azhar University. The animals were accustomed to standard conditions (temperature 23± 2°C, with a light/dark cycle of 12 hr) with a 12-h light/dark cycle for 7 days before the starting of the experiment. They could freely access water and food and were housed in ideal conditions throughout the experiment.

Ethics approval

Our research follows internationally recognized guidelines on animal welfare. The experiments were performed following the guidelines for the care and use of experimental animals introduced by the USA National Institute of Health (NIH, 1985), This experiment was carried out under Egyptian ethical codes for studies on experimental animals and approved by the Ethics Committee of Al-Azhar University. The experimental protocol was approved by the Biological and Environmental Sciences Department, Faculty of Home Economics, Al-Azhar University, Egypt.

Experimental design

After compatibility, the animals were randomly separated to eleven groups, 6 animals each and treated as follows: Group 1: Rats received distilled water orally (negative control(. Group 2: Rats received orally Coca-Cola beverage (10 ml/kg) daily with stomach tube (positive group). Group3: Rats received Coca-Cola with chitosan (200 mg/ Kg/day(. Group 4: Rats received Coca-Cola with nano chitosan (500 mg/ Kg/day(. Group 5: Rats received Coca-Cola with selenium (0.5mg/kg). Group 6: Rats received Coca-Cola with nano selenium (0.5mg/kg). Group 7: Rats received 7-Up (10 ml/Kg/day( and considered as a positive group.

Group 8: Rats received 7-Up with chitosan (200 mg/ Kg/day(. Group 9: Rats received 7-Up with nano chitosan (500 mg/ Kg/day(. Group 10: Rats received 7-Up with selenium (0.5mg/kg). Group 11: Rats received 7-Up with nano selenium (0.5mg/kg).

Study procedures

The rats were weighed every week. They were observed during the period of experimental for signs of death and toxicity. When the experiment is over, rats have fasted overnight, then they

http://annalsofrscb.ro 17048

were sacrificed after weighed and their organs (liver, spleen, kidney, and testis) were removed and weighed immediately after sacrifice. The liver was quickly removed and processed for histopathological and genetic studies. Blood samples were collected in a tube without EDTA and allowed to coagulate, after that the samples were centrifuged at 4000 rpm for twenty minutes to have sera samples. Serum samples were reserved at −20◦C till used for biochemical assays.

Histopathological examination :-

For histopathological analysis, small pieces of liver were obtained and fixed in 10% formalin solution. The pieces were dehydrated in 70–100% ethanol, cleared in xylene, then embedded in paraffin. Paraffin sections were cut with thick of 5 µm, then prepared to be stained with hematoxylin and eosin dyes ²⁸, then examined microscopically.

Biochemical analysis:

The serum samples were extracted from blood mice to measure some liver enzymes activity as Aspartate aminotransferase (AST) and Alanine aminotransferase (ALT) ^{29, 30}. Also, some biochemical analysis were measured in mice blood as total cholesterol³¹, Triglycerides³², high-density lipoprotein cholesterol (HDL-c) ³² and Blood sugar (Rbs) ³³.

Relative gene expression of Cyp2E1, CAT and GST1 in the liver tissue

The RNeasy kit (Qiagen) is used to isolate RNA from the liver ³⁴, The purity and integrity of RNA were assessed by Nanodrop spectrophotometer, and 1% agarose gel electrophoresis, respectively. The Quantiscript reverse transcriptase is employed in RNA reverse transcription to cDNA. Real-time PCR reaction contains cDNA as a template using QuantiTect SYBR Green qPCR Master Mix and gene-specific primers, designed by the Primer 3 web-based tool based on the published rats sequence (Table 1), along with Step One Plus real-time PCR system (Applied Biosystem, USA), and reaction cycles ³⁵. The critical threshold (Ct) quantities for the studied genes were normalized with the Ct quantities of the β-actin gene (internal control)

Table (1) Forward and reverse primers sequence for the studied genes and β-actin gene.

Gene Forward primer

(^/5 --- ^/3)

Reverse primer (^/5 --- ^/3)

CYP2E1 TGGAACCTGCCCCCAGGACC CGAAGCGCTTTGCCAACTTGGTT

CAT GAATGGCTATGGCTCACACA CAAGTTTTTGATGCCCTGGT

GST1 TGCCATAATGCGCTACCTTG AAGCATGATGAGCTGCATGC

B actin TCCTTCCTGGGCATGGAGTC GGATGTCCACGTCGCACTTC

Statistical analysis

The data were presented as means ±SD. The statistical significance was calculated by one- way ANOVA (analysis of variance) using SPSS, 20 software, and the individual comparisons between treatments were measured by Duncan's multiple range test (DMRT). When p<0.05, the data were regarded statistically significant.

RESULTS

Effect of SD consumption only or with other substances on the rats body and organs weight.

The daily consumption of SD increased in the body weight of rats, also, the liver and spleen weight change after consumption SD, there is no change in both kidney and tests weight (Table 2 ). The treatment with SeNps recovery the body weight as the negative control. The treatment with chitosan was active in body, liver and spleen weights.

http://annalsofrscb.ro 17049

Table ( 2 ) Effect of soft drink consumption only or with other substances on the body and organs weight of rats.

Treatment Body weight M ± SD (gm)

Liver M ± SD (gm)

Spleen M ± SD (gm)

Kidney M ± SD (gm)

Tests M ± SD (gm) G1 216.50± 3.61^c 7.46±0.45^b 1.07±0.07^bc 0.70±0.1^ab 1.28±0.23 G2 229.16± 4.95^a 8.11±0.4^a 1.13±0.09bc 0.75±0.06^a 1.26±0.24 G3 213.66±2.94^cde 7.28±0.67^bc 1.06±0.07^bc 0.67±0.14^ab 1.23±0.27 G4 210.33± 2.87^e 6.77±0.46^cd 1.01±0.03^c 0.69±0.09^ab 1.2±0.24 G5 214.83±3.86^cde 7.47±0.39^b 1.04±0.03^c 0.66±0.06^b 1.33±0.1 G6 216.00± 2,09^cd 6.65±0.57^cd 1.02±0.18^c 0.68±0.06^ab 1.32±0.11 G7 224.83±3.31^b 6.54±0.32^d 1.28±0.09^a 0.71±0.05^ab 1.24±0.18 G8 210.20± 3.27^e 6.26±0.33d^e 1.17±0.04^b 0.68±0.08^ab 1.22 ±0.13 G9 211.60± 2.88^de 5.8±0.85^e 1.08±0.04^bc 0.66±0.1^b 1.17±0.11 G10 210.33± 2.65^e 5.68±0.21^e 1.07±0.06^bc 0.64±0.08^b 1.15±0.16 G11 213.33± 4.41^cde 5.8±0.24^e 1.02±0.08^c 0.67±0.11^ab 1.23±0.17

sig 0.00 0.00 0.00 0.26 0.41

Means followed by a similar letter within a column for each parameter are not significantly different at the 0.05 level of probability by Duncan's Multiple –Range Test.

Effect of soft drink consumption only or with other substances on the liver enzymes and some biochemical indicators of rats.

Coca-Cola and 7up consumption increase the liver enzyme, also, they increase the level of cholesterol, triglyceride, and Rbs. On the contrary, they decrease the level of HDL compared to the negative control. About Coca-Cola, the treatment of SeNps was the best in recovery to the normal rate in both AST, AlT, cholesterol, and Rbs. Following by selenium treatment in both cholesterol, triglyceride and HDL. In 7up groups, selenium and SeNps ameliorate the side effect of 7up concerning cholesterol, triglyceride, and HDL (Table 3).

Table ( 3 ) Effect of soft drink consumption only or with other substances on the liver enzymes and some biochemical indicators of rats.

Treatment ALT(U/L) AST(U/L) Cholesterol (mg/dL)

Triyglysride

(mg/dL) HDL(mg/dL) Rbs(mg/dL) G1 74.33±6.80^c 194.33±8.96^c 123.00±1.00^c 92.00±4.35^d 49.00±2.44^a 129.00±6.58^d G2 105.80±25.27^a 235.16±32.65^a 131.75±4.03^a 122.25±20.7^a 44.16±3.86^c 165.60±13.06^a G3 88.00±18.53^abc 200.16±25.85^bc 122.00±2.44^c 106.75±4.78^bc 46.00±1.78^abc 155.80±9.01^abc G4 81.40±8.96^bc 209.40±28.82^abc 124.33±0.57^c 109.00±3.00^abc 48.00±1.54^ab 137.20±5.35^bcd G5 81.00±10.48^bc 214.25±4.64^abc 122.33±2.51^c 105.66±3.21^bcd 48.00±1.50^ab 155.50±12.67^abc G6 80.80±10.66^bc 197.50±17.46^bc 124.33±1.15^c 111.33±2.08^abc 47.50±3.44^abc 136.66±8.28^cd G7 100.00±13.41^ab 230.00±9.34^ab 130.25±3.09^ab 119.00±1.00^ab 45.00±2.82^bc 154.00±41.03^abc G8 81.75±8.46^bc 197.00±14.99^bc 126.40±2.07^bc 112.00±2.64^abc 45.83±2.63^abc 158.25±6.39^ab G9 86.40±10.59^abc 209.50±8.02^abc 123.50±2.64^c 111.00±3.60^abc 48.33±3.32^ab 165.00±5.00^a G10 80.60±12.75^bc 204.66±28.15^abc 123.66±3.78^c 113.66±2.08^abc 48.83±1.94^a 138.00±5.56^bcd

http://annalsofrscb.ro 17050

G11 80.83±11.47^bc 198.20±10.18^bc 124.00±1.00^c 102.33±3.51^cd 48.16±.983^ab 136.25±12.50^cd

sig 0.03 0.05 0.00 0.00 .018 0.001

ALT: Alanine aminotransferase, AST: Aspartate aminotransferase, Rbs: Random blood sugar, HDL: High density lipopolysaccharides.

Effect of SD consumption on gene expression of Cyp2E1, CAT and GST1 in the liver tissue.

Rt-PCR results showed significant downregulation in the expression levels of Cyp2E1 and CAT genes in the rats liver treated with Coca-Cola (G2) and 7‑UP(G7) in comparison to the group of negative control (G1) (Fig 3). This reduced expression was notably upregulated following treatment with chitosan (G3, G8), nano chitosan (G4, G9), selenium (G5, G10), and SeNps (G6, G11), with the highest expression in nano chitosan followed by SeNps. However, the expression remained lower than that of the group of negative control (G1). About GST1, the results showed that both Coca-Cola and 7up have different effects on GST1 gene expression. As for 7up(G7), it worked in increasing the gene expression level in comparison to the negative control (G1), while Coca-Cola (G2), reduced the gene expression level in comparison with the negative control (G1) (Fig 3). This increase and decrease in the gene expression level were significant. As well, the other treatments worked on a change in the gene expression level. The highest value was in the treatment of SeNps (G6) followed by chitosan (G3) and the lowest was in the treatment of nano chitosan (G4). Selenium (G5) is the only treatment that adjusted the gene expression like the negative control. The other treatment up regulated the gene expression about control while the nano-chitosan down regulated the expression level about control.

http://annalsofrscb.ro 17051

Fig. (3). Relative expression of Cyp2E1, CAT and GST1 (compar to β-actin as internal control) genes in the liver of rat treated with SD only or combination with natural or nanomaterials.

Histopathological findings

http://annalsofrscb.ro 17052

Fig (4,5) illustrated the most histopathological changes induced by Coca-Cola and 7up administration. These changes include lymphocytes aggregation in the portal area, fibrosis and congestion of portal vein also, dilatation and congestion of central vein, formed newly bile ductuls, karyolysis and pyknotic nuclei, degeneration of cytoplasm with kupffer cells activity (Fig.4 B, C, and D) and (Fig.5 B, C). The treatment SD with chitosan shows normal central vein and hepatocytes with slight rupture of endothelial cells in Coca-Cola treatment(Fig.4 E), and slight infiltration of lymphocytes in 7up treatment (Fig.5, D). The administration of SD-treated rats with nano chitosan shows normal central vein, recovery of hepatocytes, and activity of kupffer cells are noticed (Fig.4, F) and (Fig.5, E, F). The administration of SD-treated rats with selenium is showing normal appearance of hepatocyte radiated from a central vein and slightly proliferation of kupffer cells in cola(Fig.4 G), normal central vein (CV) with slight congestion in 7up treatment (Fig.5 G).SD and SeNps treatment is showing hepatocytes recovery with normal central vein, recovery of hepatocytes, with normal appearance of sinusoids and slightly proliferation of kupffer cells are noticed in cola treatment(Fig.4 H) and congestions of central vein in 7up treatment (Fig.5 H)

http://annalsofrscb.ro 17053 Fig. (4). Histopathological changes in the liver of rat induced by Coca-Cola consumption only or combined with the other treatments. A: Section in the liver of control rats are showing normal appearance hepatic cells (H) radiating from central vein (CV). Also, sinusoids (S) and kupffer cells (K) are noticed. B, C, and D: The rat liver is treated with coca cola showing high aggregation of lymphocytes ( L) at the portal area, fibrosis and congestion of portal vein (pv) and formed newly bile ductuls (BD), some nuclei are karyolitic (Y), degeneration of cytoplasm (DC), most nuclei are pyknotic(P), some nuclei are karyolitic (Y) activity in kupffer cells (K), and dilatation and congestion of central vein (CV) with infiltration of monocytes (L). E: Section in the rat liver is treated with coca cola and chitosan showing normal central vein (CV) with slightly rupture of endothelia cells (EC), normal sinusoids (S) and recovery of nuclei are noticed. F: The liver of rat treated with coca cola and nano chitosan is showing normal central vein (CV), recovery of hepatocytes (H) and activity of kupffer cells are noticed (K). G: Section in the liver of rat treated with coca cola and selenium is showing normal appearance of hepatocytes (H) radiated from central vein (cv), and slightly proliferation of Kupffer cells (K). H: The liver of rat treated with coca cola and nano selenium is showing normal central vein (CV), recovery of hepatocytes (H) , with normal appearance of sinusoids (S) and slight proliferation of kupffer cells are noticed (K).: H&E, × 400.

http://annalsofrscb.ro 17054 Fig. (5). Histopathological changes in the liver of rat induced by 7-UP consumption only or combined with the other treatments. A: Section in the liver of control rat showing normal appearance hepatic cells and central vein (CV). B, C: The liver of rat treated with 7-UP is showing portal area with high aggregation of lymphocytes infiltration (L), thickness and congestion of portal vein (pv), and proliferation of bile duct (BD). Also, we can see small and large hepatocytes nuclei with pyknotic (Y),karyolasis of some nuclei, most of nuclei are pyknotic(P), hemorrhage in sinusoids (S)and degeneration of cytoplasm (DC). D: The liver of rat treated with 7- UP and chitosan showing normal appearance of hepatocytes (H) and central vein (CV) with slight infiltration of lymphocytes (L). E: The rat liver treated with 7-UP and nano chitosan is showing normal appearance of hepatocytes (H) radiated from central vein (CV), slightly of kupffer cells (K), are observed. F: Section in the rat liver treated with 7-UP and nano chitosan is showing normal appearance of hepatocytes (H) radiated from central vein (CV) and normal appearance of central vein with slightly congestion(CV). G: The liver of rat treated with 7-UP and selenium is showing normal central vein (CV) with slightly congestion, normal hepatocytes (H) and sinusoids (S). H: Section in the liver of rat treated with 7-UP and nano selenium is showing hepatocytes recovery (H),normal sinusoids (S) and congestions of central vein (CV).

DISCUSSION

Organ weight is among the most sensitive drug toxicity indicators, and its changes often precede morphological changes ³⁶. The findings revealed that the SD (Coca-Cola and 7up) increasing of body weight of rats. This increase agrees with the majority of meta-analyses and systematic reviews support the view that sugary drinks, particularly SD, have a causative role in obesity ³⁷. The carbonated SD contribute to an increase in weight and result in obesity and other health problems due to obesity ^{38, 39}. Other study found that after seven weeks of Coca-Cola and Pepsi administration, the liver weight was significantly increased ¹⁰. Chitosan recovers the body, spleen, and liver weight to the normal range and this result agrees with other studies on obesity in rats and the influence of chitosan in decrees the liver and body weights in comparison with the positive control ^{40, 41}. The chitosan can't be digested in the intestine this would suggest the mechanism of this effect might be due to a decline in the absorption of fat and this also is the explanation for the liver's lack of weight for groups of SD

42. The liver is the major organ in the body which serves an vital function in drugs and food metabolism, and any change in its role induces deleterious effects ⁴³. Elevated serum ALT, AST content is a biochemical marker for liver injury ⁴⁴. Soft drinks generate oxidative stress in the rat's liver ¹⁰, the free radicals resulting from oxidative stress cause the oxidative damage of lipids, lipoproteins, and other biochemical parameters such as enzymes, nucleic acids, and proteins. Results show an increase in serum ALT, AST of rats indicating that liver functioning is disturbed ⁴⁵. These effects may be returned to the effect of sugars, acids, flavor, caramel, and caffeine found in soda SD of these beverages. Our results agree with other study where they found that the intake of SD causes liver injury thereby increasing the liver enzyme activity (ALT and AST activity) ⁴⁶. Also, there was increasing in cholesterol, triglycerides (TG), and Random blood sugar (Rbs) while there was decreasing in high- density lipopolysaccharides (HDL) ^{47, 48}. The therapy with selenium and SeNps recovery the normal liver enzyme and most of the other biochemical markers studied. The liver-enzyme enhancement in both of the treatments selenium and SeNps agree with other studies on the impact of other harmful material (paracetamol ) on the liver and the use of selenium and SeNps in reducing the side effect of it ⁴⁹. Also, selenium and SeNps reduce the levels of triglycerides, total lipids, and cholesterol, and raised HDL levels ^{50, 51}. Selenium supplementation decreased hypercholesterolemia by increasing paraoxonase 1 activity. This enzyme protects membranes, HDL-c, and LDL-c from oxidative changes by catalyzing the oxidized phospholipids hydrolysis ⁵². The function of selenium in the catalytic site of the selenoenzyme glutathione peroxidase is the majority essential antioxidant component of selenium. Glutathione peroxidase not just removes the radicals of toxic substances but also allows the lipid molecules regeneration by reacylation in the cellular membrane. GSH-Px

http://annalsofrscb.ro 17055

(one of the enzymes that scavenge ROS) was significantly decreased (P<0.05) in the rat's serum in the Coca-Cola and 7-UP groups in comparison with the control rats ¹⁰.

Cytochromes P450 (CYP450) is the core phase I metabolic enzymes involved in the biotransformation of xenobiotics and endogenous compounds to form electrophilic RMs ⁵³. The activity of CYP450 is characterized by a high inter-individual variability due to environmental factors, such as diet, drug therapy, and toxic substances. CYP450 isoform active can affect drug or food metabolic activation ⁵⁴. CYP2E1 is one of the cyp450s mixed- function oxidase systems, that is implicated in the xenobiotics metabolism in the body ⁵⁵. Our results indicate that cola and 7up have a significant inhibition in the Cyp2E1 expression levels in the rat's liver in comparison with the negative control and the other treatments. The same results were found in the previous study ¹⁰, they found that the intake of SD induced oxidative stress in the rat's liver, also, SD induced alterations in mRNA expression of hepatic cytochrome isoform. Thus, the inhibition effect of SD on Cyp2E1 like the CYP2B1 isoform in other studies ¹⁰ this reduction may be mediated throughout caffeine activation of AMPK-dependent enhancement of CAR phosphorylation. Also, The Cyp2E1reduction by SD may be attributed to the presence of taurine ¹⁰. Taurine supplementation considerably reduced the enzyme activity and expression (protein and mRNA) of CYP2E1 in diabetic rat kidneys⁵⁶. So, our study refers to SD can significantly decrease hepatic CYP2E1. Otherwise, the treatment with nature and nanomaterials (chitosan, nano chitosan, selenium, and nano selenium) eliminate the side effect of SD and they return the gene expression to the normal level. The nanomaterial has the best effect concerning CYP2E1 expression rather than the material in the normal formation. Chitosan and nano chitosan are used for the first time in reducing the side effect of SD. Chitosan increases cyp2E1 expression. In contrast previous study reported that antioxidants of chitosan didn’t prevent the CYP2E1 degradation induced by CCl4 suggesting that the CYP2E1 degradation processes are not directly related to the chitosan antioxidant effects ⁵⁷. So, the only explanation for this gene expression increase after chitosan treatment may be dependent on chitosan's capacity in formation complex with inorganic salts ⁵⁸. Chitosan can bind with many material that can induce degradation in gene expression. Chitosan nanoparticles display more superior actions compared with chitosan also, it has been mentioned that chitosan nanoparticles have increased immune-enhancing effect, antimicrobial activity, and anticancer activity greater than that of chitosan. Besides, nanoparticles possess a stronger curvature of the surface, compared to large particles ⁵⁹. In this study nano chitosan has a defensive effect than those of chitosan. Also, the nanoform of selenium alleviates the side effect of SD than of selenium. These return to their lower toxicity and high bioavailability than inorganic and organic forms ⁶⁰.

A catalase (CAT) is one of the vital antioxidant enzymes which minimizes oxidative stress to a significant extent by destroying hydrogen peroxide in the cell to create water and oxygen ⁶¹. In comparison to the negative control group and other therapies, our findings show that Coca- Cola and 7up cause a substantial decrease in the CAT expression levels in the rat's livers. The intake of SD raises the oxidative stress in the rat's liver and induced alterations in CAT gene expression(10). Oxidative stress produces after consumption of SD which leads to the inability of antioxidant defense mechanisms to scavenge excessive levels of reactive oxygen.

This explains the low level of CAT is because of the elevated oxidative stress level.

Moreover, the treatment with nature and nanomaterials (nano chitosan, nano selenium, chitosan, selenium respectively) upregulates the expression of the CAT gene. This indicates that these substances have contributed to the reorganization of the expression of the CAT gene, especially the nanomaterials. Our results agree with other study ⁶², they reported that nano chitosan has a rapid and significantly enhanced expression of CAT genes compared to the untreated control seedlings. SeNps treatment upregulated the expression of mRNA and

http://annalsofrscb.ro 17056

this agrees with other study ⁶³ who found that SeNps up regulated and activated antioxidant- enzyme mRNA expression as CAT in the hippocampus. Also, the SeNps raises the mRNA expression of COX-2 CAT, and GPx1 levels ⁶⁴. In other study, the levels of liver CAT mRNA at the fourth week were markedly decreased when Se was added to the chicken diet, it looks that Se status under certain conditions, i.e. cell type, vitamin availability, different species, influence both gene expression and catalytic of this non-selenoenzyme ⁶⁵. SeNps protects the liver from hepatotoxicity caused by APAP through improved liver function and oxidative stress via catalase, SOD, and GSH and decreases hepatic DNA fragmentation, a hepatic biomarker of cell death. SeNps could be a new hepatoprotective substance to prevent oxidative stress ⁶⁶.

Chronic SD consumption induced oxidative stress, metabolic changes, and changes in gene expression in rats ¹⁰. The glutathione S-transferase (GST) is isoenzyme superfamilies that detoxify toxic environmental substances. It is commonly expressed in the tissues of mammalian. GSTs play a main effect in the lipids metabolism and the deactivation of reactive oxygen species ⁶⁷. The current study's findings supported that both Coca-Cola and 7up have a diverse effect on GST1 gene expression. As for Coca-Cola, it decreases the gene expression level in comparison with the negative control while 7up worked on increasing the level of gene expression in comparison with the negative control. Intake of Cola for three months reduces the mRNA expression of GST ⁶⁸. On the other hand, the majority of the treatment with nature and nanomaterials upregulated the expression about control except for selenium that reorganized the gene expression of GST1 gene. Similarly, the previous study reported that the expression of GST-1 genes encoding the antioxidative enzymes was enhanced with selenium application⁶⁹.

Coca-Cola and 7up treatments induced histological changes in the liver of the rat. This agrees with the amplify in the enzymes of the liver which increase in pathological cases as a result of the destruction of liver cells then the enzymes are leaking out of tissue contents into the bloodstream ⁷⁰.

The majority of the histopathological alteration include congestion, karyolysis, pyknotic nuclei, this agrees with many reports ^{71, 10, 48}. Moreover, a markedly increase in ALT and AST activities because the directly severe physiological effects caused by the interaction of toxins with mitochondria and cellular membranes, or indirectly through free radicals action. Hence, it may result in extensive liver parenchyma breakdown and subsequent enzyme release leading to their increase in the blood ⁷². The treatment by chitosan, nano chitosan, selenium, and SeNps reduce the histopathological changes induced with Coca-Cola or 7up consumption. Chitosan has an advantage in exerting a markedly hepatoprotective effect against fatty liver ^{73, 74}, and subsequently chitosan showed a markedly decrease in serum AST, ALT ⁷³. The chitosan hepatoprotective effect might be ascribable to its anti- inflammatory and/or antioxidant property therefore, it was speculated that it could inhibit free radical activity in a model of SD. Many references indicated the effective role of nano chitosan in reducing the side effects of many toxic compounds on the liver, ^{75, 76}. The cirrhotic changes and fibrotic in the liver were reduced after being treated with selenium and SeNps.

Selenium plays an important role in the protection of cell membranes from oxidative destruction because it is an important constituent of the glutathione peroxidase enzyme which destroys lipid damaging peroxides ⁷⁷. Other study reported that loss of selenium causes necrosis in experimental animals ⁷⁸. Several studies showed that SeNps has antioxidant activities in vitro and in vivo through the activation of selenium enzymes like glutathione peroxidase (GPx) and thioredoxinreductase (TrxR) which prevents oxidative damage to body tissues ^{79, 80} it is the first time to study these materials with intake of Coca-Cola and 7up.

http://annalsofrscb.ro 17057

CONCLUSION

Many reports indicated the side effect of soft drinks on liver function and gene expression in rats. This study focuses on the substances that alleviate the harmful effect of soft drinks.

Nanomaterials of chitosan and selenium have a significant effect in eliminating the Genetical and histological change induced by soft drinks. The current study demonstrated the potential therapeutic efficacy of chitosan and selenium nanoparticles against the harmful effects of soft drinks on the liver and on gene expression, but more studies are needed to understand the protective mechanism.

SIGNIFICANCE STATEMENT

Soft drinks consumption has increased worldwide in the past decades, although several studies pointed toward its associations with obesity, liver diseases , kidney, and osteoporosis.

In this study, nano chitosan has a defensive effect more than chitosan. Also, the nanoform of selenium alleviates the side effect of soft drinks more than selenium. These return to their lower toxicity and high bioavailability than inorganic and organic forms. So;

1- Reducing the consumption of soft drinks because of their harm to health.

2- The treatment with natural products as nanosize particles as (chitosan, nano chitosan, selenium, and nano selenium) eliminate the side effect of soft drinks

3- Selenium plays an important role in the protection of cell membranes from oxidative destruction because it is an important constituent of the glutathione peroxidase enzyme which destroys lipid damaging peroxides

4- Chitosan has an advantage in exerting a markedly hepatoprotective effect against fatty liver, The chitosan hepatoprotective effect might be ascribable to its anti-

inflammatory and/or antioxidant property therefore

CONFLICT OF INTEREST

The authors declare that there are no conflicts of interests.

REFERENCES

[1] Hatch EE, Wise LA, Mikkelsen EM, Christensen T, Riis AH, Sørensen HT, Rothman KJ.

Caffeinated beverage and soda consumption and time to pregnancy. Epidemiology (Cambridge, Mass.). 2012 May;23(3):393-401. DOI: 10.1097/EDE.0b013e31824cbaac.

[2] Cuomo R, Andreozzi P, Zito FP. Alcoholic beverages and carbonated soft drinks:

consumption and gastrointestinal cancer risks. Advances in Nutrition and Cancer. 2014:97- 120. DOI: 10.1007/978-3-642-38007-5_7.

[3] Adjene JO, Ezeoke JC, Nwose EU. Histological effects of chronic consumption of soda pop drinks on kidney of adult Wister rats. North American journal of medical sciences. 2010 May;2(5):215. DOI: 10.4297/najms.2010.2215.

[4] Fung TT, Malik V, Rexrode KM, Manson JE, Willett WC, Hu FB. Sweetened beverage consumption and risk of coronary heart disease in women. The American journal of clinical nutrition. 2009 Apr 1;89(4):1037-42. DOI: 10.3945/ajcn.2008.27140.

[5] Yip HH, Wong RW, Hägg U. Complications of orthodontic treatment: are soft drinks a risk factor?. World journal of orthodontics. 2009 Mar 1;10(1). PMID: 19388431.

http://annalsofrscb.ro 17058

[6] Rapuri PB, Gallagher JC, Kinyamu HK, Ryschon KL. Caffeine intake increases the rate of bone loss in elderly women and interacts with vitamin D receptor genotypes. The American journal of clinical nutrition. 2001 Nov 1;74(5):694-700. DOI: 10.1093/ajcn/74.5.694.

[7] Bray GA, Nielsen SJ, Popkin BM. Consumption of high-fructose corn syrup in beverages may play a role in the epidemic of obesity. The American journal of clinical nutrition. 2004 Apr 1;79(4):537-43. DOI: 10.1093/ajcn/79.4.537.

[8] Vartanian LR, Schwartz MB, Brownell KD. Effects of soft drink consumption on nutrition and health: a systematic review and meta-analysis. American journal of public health. 2007 Apr;97(4):667-75. DOI: 10.2105/AJPH.2005.083782.

[9] Malik VS, Schulze MB, Hu FB. Intake of sugar-sweetened beverages and weight gain: a systematic review–. The American journal of clinical nutrition. 2006 Aug 1;84(2):274-88.

DOI: 10.1093/ajcn/84.1.274.

[10] Alkhedaide A, Soliman MM, Salah‑Eldin AE, Ismail TA, Alshehiri ZS, Attia HF.

Chronic effects of soft drink consumption on the health state of Wistar rats: A biochemical, genetic and histopathological study. Molecular medicine reports. 2016 Jun 1;13(6):5109-17.

DOI: 10.3892/mmr.2016.5199.

[11] Rajkapoor B, Venugopal Y, Anbu J, Harikrishnan N, Gobinath M, Ravichandran V.

Protective effect of Phyllanthuspolyphyllus on acetaminophen induced hepatotoxicity in rats.

Pak J Pharm Sci. 2008 Jan 1;21(1):57-62. PMID: 18166521

[12] Olteanu D, Filip A, Mureşan A, Nagy A, Tabaran F, Moldovan R, Decea N, Catoi C, Clichici S. The effects of chitosan and low dose dexamethasone on extrahepatic cholestasis after bile duct ligation in Wistar rats. ActaPhysiologicaHungarica. 2012 Mar 1;99(1):61- 73.DOI: 10.1556/APhysiol.99.2012.1.7. PMID: 22425809.

[13] Olaleye MT, Akinmoladun AC, Ogunboye AA, Akindahunsi AA. Antioxidant activity and hepatoprotective property of leaf extracts of Boerhaaviadiffusa Linn against acetaminophen-induced liver damage in rats. Food and Chemical Toxicology. 2010 Aug 1;48(8-9):2200-5. DOI: 10.1016/j.fct.2010.05.047. PMID: 20553784.

[14] Cheung RC, Ng TB, Wong JH, Chan WY. Chitosan: an update on potential biomedical and pharmaceutical applications. Marine drugs. 2015 Aug;13(8):5156-86.

DOI: 10.3390/md13085156.

[15] Kumar S, Koh J, Kim H, Gupta MK, Dutta PK. A new chitosan–thymine conjugate:

Synthesis, characterization and biological activity. International journal of biological macromolecules. 2012 Apr 1;50(3):493-502. DOI: 10.1016/j.ijbiomac.2012.01.015.

PMID: 22285484.

[16] Martins AF, Facchi SP, Follmann HD, Pereira AG, Rubira AF, Muniz EC. Antimicrobial activity of chitosan derivatives containing N-quaternized moieties in its backbone: a review.

International Journal of Molecular Sciences. 2014 Nov;15(11):20800-32.

DOI: 10.3390/ijms151120800.

[17] Ngo DH, Kim SK. Antioxidant effects of chitin, chitosan, and their derivatives.

Advances in food and nutrition research. 2014 Jan 1;73:15-31. https://doi.org/10.1016/B978- 0-12-800268-1.00002-0.

[18] Rayman MP. Selenium and human health. The Lancet. 2012 Mar 31;379(9822):1256-68.

DOI: 10.1016/S0140-6736(11)61452-9. Epub 2012 Feb 29. PMID: 22381456.

[19] Shahri, S.H., Hajinezhad, M.R. and Jamshidian, A., 2021. Comparison of the Histopathological Effects of Selenium Nanoparticles and Cerium Oxide Nanoparticles in Cadmium-intoxicated Rabbits. Journal of Environmental Treatment Techniques, 9(2), pp.528-

533. Journal web link: https://dormaj.org/index.php/jett

https://doi.org/10.47277/JETT/9(2)533.

http://annalsofrscb.ro 17059

[20] Divya K, Jisha MS. Chitosan nanoparticles preparation and applications. Environmental chemistry letters. 2018 Mar;16(1):101-12. DOI:10.1007/s10311-017-0670-y.

[21] Arulnathan N, Karunakaran R, Balakrishanan V, Chellapandian M, Geetha K. Synthesis and Characterization of Nano Selenium as Feed Supplement. International Journal of Science, Environment and Technology. 2016 5;4:2296-2300.

[22] Abdel-Wahhab MA, Aljawish A, El-Nekeety AA, Abdel-Aiezm SH, Abdel-Kader HA, Rihn BH, Joubert O. Chitosan nanoparticles and quercetin modulate gene expression and prevent the genotoxicity of aflatoxin B1 in rat liver. Toxicology reports. 2015 Jan 1;2:737-47.

https://doi.org/10.1016/j.toxrep.2015.05.007.

[23] El-Denshary ES, Aljawish A, El-Nekeety AA, Hassan NS, Saleh RH, Rihn BH, Abdel- Wahhab MA. Possible synergistic effect and antioxidant properties of chitosan nanoparticles and quercetin against carbon tetrachloride-induce hepatotoxicity in rats. Soft Nanoscience Letters. 2015 April 5;2:36-51. DOI: 10.4236/snl.2015.52005.

[24] Ingle A, Gade A, Pierrat S, Sonnichsen C, Rai M. Mycosynthesis of silver nanoparticles using the fungus Fusariumacuminatum and its activity against some human pathogenic

bacteria. Current Nanoscience. 2008 May 1;4(2):141-4.

DOI : 10.2174/157341308784340804.

[25] Kondal A, Garg SK. Influence of acidic beverage (Coca-Cola) on pharmacokinetics of ibuprofen in healthy rabbits. Indian J ExpBiol . 2003 Nov;41(11):1322-4. PMID: 15332505.

[26] Hu Y, Jiang X, Ding Y, Ge H, Yuan Y, Yang C. Synthesis and characterization of chitosan–poly (acrylic acid) nanoparticles. Biomaterials. 2002 Aug 1;23(15):3193-201.

DOI: 10.1016/s0142-9612(02)00071-6. PMID: 12102191.

[27] Li Q, Chen T, Yang F, Liu J, Zheng W. Facile and controllable one-step fabrication of selenium nanoparticles assisted by L-cysteine. Materials letters. 2010 Mar 15;64(5):614-7.

https://doi.org/10.1016/j.matlet.2009.12.019.

[28] Suvarna KS, Layton C, Bancroft JD, editors. Bancroft's theory and practice of histological techniques E-Book. Elsevier Health Sciences; 2018 Feb 27.

[29] Henry RJ. Clinical Chemist. Principles and Techniqus, 2nd Edition, Hagerstown (MD), Harcer, Row. 1974;882.

[30] Yound DS. Determination of GOT. Clin. Chem. 1975;22(5):1-21.

[31] Allain CC, Poon LS, Chan CS, Richmond WF, Fu PC. Enzymatic determination of total serum cholesterol. Clinical chemistry. 1974 Apr 1;20(4):470-5.

https://doi.org/10.1093/clinchem/20.4.470.

[32] Robbins DC, Welty TK, Wang WY, Lee ET, Howard BV. Plasma lipids and lipoprotein concentrations among American Indians: comparison with the US population. Current opinion in lipidology. 1996 Aug 1;7(4):188-95. DOI: 10.1097/00041433-199608000-00003.

PMID: 8883492.

[33] Airaodion AI, Airaodion EO, Ogbuagu EO, Ogbuagu U, Osemwowa EU. Effect of oral intake of African locust bean on fasting blood sugar and lipid profile of albino rats. Asian Journal of Research in Biochemistry. 2019 May 21:1-9. DOI: 10.9734/ajrb/2019/v4i430073.

[34] Abd-Allah SH, Shalaby SM, Abd-Elbary E, Saleh AA, El-Magd MA. Human peripheral blood CD34+ cells attenuate oleic acid–induced acute lung injury in rats. Cytotherapy. 2015 Apr 1;17(4):443-53. DOI: 10.1016/j.jcyt.2014.11.002. PMID: 25536864.

[35] Khamis AA, Ali EM, Abd El-Moneim MA, Abd-Alhaseeb MM, El-Magd MA, Salim EI.

Hesperidin, piperine and bee venom synergistically potentiate the anticancer effect of tamoxifen against breast cancer cells. Biomedicine & Pharmacotherapy. 2018 Sep 1;105:1335-43. DOI: 10.1016/j.biopha.2018.06.105. PMID: 30021371.

http://annalsofrscb.ro 17060

[36] Piao Y, Liu Y, Xie X. Change trends of organ weight background data in Sprague Dawley rats at different ages. Journal of toxicologic pathology. 2013;26(1):29-34.

DOI: 10.1293/tox.26.29. PMID: 23723565.

[37] Vartanian LR, Schwartz MB, Brownell KD. Effects of soft drink consumption on nutrition and health: a systematic review and meta-analysis. American journal of public health. 2007 Apr;97(4):667-75. DOI: 10.2105/AJPH.2005.083782.

[38] Bocarsly ME, Powell ES, Avena NM, Hoebel BG. High-fructose corn syrup causes characteristics of obesity in rats: increased body weight, body fat and triglyceride levels.

Pharmacology Biochemistry and Behavior. 2010 Nov 1;97(1):101-6. DOI:

10.1016/j.pbb.2010.02.012.

[39] Nisar T, Lodhi A, Imran M, Khalil AA, Gilani SA, Ali SW, Amir RM. Effect of Carbonated Drinks on Biochemical Parameters of Rat Serum. Journal of Environmental and Agricultural Sciences. 2018, 14: 31-38.

[40] Xia T, Li N, Nel AE. Potential health impact of nanoparticles. Annual review of public health. 2009 Apr 21;30:137-50. DOI:10.1146/annurev.publhealth.031308.100155.

[41] Zhang HL, Zhong XB, Tao Y, Wu SH, Su ZQ. Effects of chitosan and water-soluble chitosan micro-and nanoparticles in obese rats fed a high-fat diet. International journal of nanomedicine. 2012 ;7:4069. DOI: 10.2147/IJN.S33830.

[42] Asha KK, Nair PG. Effect of chitin-chitosan treatment on fatty liver in rats with a high fat diet. Journal of Clinical Biochemistry and Nutrition. 2005;37(3):87-94.

DOI:10.3164/jcbn.37.87.

[43] Alkhedaide A, Soliman MM, Salah‑Eldin AE, Ismail TA, Alshehiri ZS, Attia HF.

Chronic effects of soft drink consumption on the health state of Wistar rats: A biochemical, genetic and histopathological study. Molecular medicine reports. 2016 Jun 1;13(6):5109-17.

PMID: 27121771 PMCID: PMC4878564. DOI: 10.3892/mmr.2016.5199

[44] Tian Z, Liu H, Su X, Fang Z, Dong Z, Yu C, Luo K. Role of elevated liver transaminase levels in the diagnosis of liver injury after blunt abdominal trauma. Experimental and therapeutic medicine. 2012 Aug 1;4(2):255-60. DOI: 10.3892/etm.2012.575.

[45] Srivastava AR, Kumar S, Agarwal GG, Ranjan P. Blunt abdominal injury: serum ALT—

a marker of liver injury and a guide to assessment of its severity. Injury. 2007 Sep 1;38(9):1069-74. DOI: 10.1016/j.injury.2007.04.019.

[46] Jeroh E, Awhin EP, Osadem L, Awire EI. Effect of carbonated drinks on the activities of Alanine Aminotransferase (ALT) and Aspartate Aminotransferase (AST) in serum and kidney in Rattusnovergicus. Asian J Biochem. 2012;7:59-62. DOI: 10.3923/ajb.2012.59.62.

[47] Leclercq IA, Horsmans Y. Nonalcoholic fatty liver disease: the potential role of nutritional management. Current Opinion in Clinical Nutrition & Metabolic Care. 2008 Nov 1;11(6):766-73. DOI: 10.1097/MCO.0b013e328312c353.

[48] AL-Askalany SA, Sadek MM, Mohamed NM. The effects of carbonated soft drinks on some biochemical blood parameter and liver histopathology of experimental rats. Egyptian Journal of Agricultural Research. 2018 Mar 1;96(1):97-109.

[49] FakhrAlmobasheri N, Shahanipour K, Monajemi R. The protective effect of selenium nanoparticles and selenium against paracetamol. Nanomedicine Journal. 2018 Jan 1;5(1):52-6.

DOI: 10.22038/NMJ.2018.05.008.

[50] Radwan NL, Eldin TS, El-Zaiat AA, Mostafa MA. Effect of dietary nano-selenium supplementation on selenium content and oxidative stability in table eggs and productive performance of laying hens. International Journal of Poultry Science. 2015 Mar 1;14(3):161.

[51] Ismaiil LA, Joumaa WH, Moustafa ME. Selenium decreases triglycerides and VLDL-c in diabetic rats exposed to electromagnetic radiation from mobile phone base stations. Journal

http://annalsofrscb.ro 17061

of Taibah University for Science. 2019 Dec 11;13(1):844-9.

https://doi.org/10.1080/16583655.2019.1649881.

[52] Kaur HD, Bansal MP. Studies on HDL associated enzymes under experimental hypercholesterolemia: possible modulation on selenium supplementation. Lipids in Health and Disease. 2009 Dec;8(1):1-0. DOI: 10.1186/1476-511X-8-55.

[53] Feng S, He X. Mechanism-based inhibition of CYP450: an indicator of drug-induced hepatotoxicity. Current drug metabolism. 2013 Nov 1;14(9):921-45.

DOI: 10.2174/138920021131400114.

[54] Zheng S, Jin X, Chen M, Shi Q, Zhang H, Xu S. Hydrogen sulfide exposure induces jejunum injury via CYP450s/ROS pathway in broilers. Chemosphere. 2019 Jan 1;214:25-34.

DOI: 10.1016/j.chemosphere.2018.09.002.

[55] Steinbrecht S, König R, Schmidtke KU, Herzog N, Scheibner K, Krüger-Genge A, Jung F, Kammerer S, Küpper JH. Metabolic activity testing can underestimate acute drug cytotoxicity as revealed by HepG2 cell clones overexpressing cytochrome P450 2C19 and 3A4. Toxicology. 2019 Jan 15;412:37-47.https://doi.org/10.1016/j.tox.2018.11.008.

[56] Yao HT, Lin P, Chang YW, Chen CT, Chiang MT, Chang L, Kuo YC, Tsai HT, Yeh TK. Effect of taurine supplementation on cytochrome P450 2E1 and oxidative stress in the liver and kidneys of rats with streptozotocin-induced diabetes. Food and chemical toxicology.

2009 Jul 1;47(7):1703-9. https://doi.org/10.1016/j.fct.2009.04.030.

[57] Jeon TI, Hwang SG, Park NG, Jung YR, Im Shin S, Choi SD, Park DK. Antioxidative effect of chitosan on chronic carbon tetrachloride induced hepatic injury in rats. Toxicology.

2003 May 1;187(1):67-73. DOI: 10.1016/s0300-483x(03)00003-9.

[58] Aziz SB, Rasheed MA, Abidin ZH. Optical and electrical characteristics of silver ion conducting nanocomposite solid polymer electrolytes based on chitosan. Journal of Electronic Materials. 2017 Oct;46(10):6119-30. DOI: 10.1007/s11664-017-5515-8.

[59] Abdel-Wahhab MA, Aljawish A, El-Nekeety AA, Abdel-Aiezm SH, Abdel-Kader HA, Rihn BH, Joubert O. Chitosan nanoparticles and quercetin modulate gene expression and prevent the genotoxicity of aflatoxin B1 in rat liver. Toxicology reports. 2015 Jan 1;2:737-47.

DOI: 10.1016/j.toxrep.2015.05.007. PMID: 28962409. PMCID: PMC5598511.

[60] Shi L, Xun W, Yue W, Zhang C, Ren Y, Shi L, Wang Q, Yang R, Lei F. Effect of sodium selenite, Se-yeast and nano-elemental selenium on growth performance, Se concentration and antioxidant status in growing male goats. Small Ruminant Research. 2011 Mar 1;96(1):49-52. https://doi.org/10.1016/j.smallrumres.2010.11.005.

[61] Nandi A, Yan LJ, Jana CK, Das N. Role of catalase in oxidative stress-and age- associated degenerative diseases. Oxidative medicine and cellular longevity. 2019 Nov 11;2019. DOI: 10.1155/2019/9613090.

[62] Siddaiah CN, Prasanth KV, Satyanarayana NR, Mudili V, Gupta VK, Kalagatur NK, Satyavati T, Dai XF, Chen JY, Mocan A, Singh BP. Chitosan nanoparticles having higher degree of acetylation induce resistance against pearl millet downy mildew through nitric oxide generation. Scientific reports. 2018 Feb 6;8(1):1-4. DOI: 10.1038/s41598-017-19016-z.

[63] Yuan X, Fu Z, Ji P, Guo L, Al-Ghamdy AO, Alkandiri A, Habotta OA, Moneim AE, Kassab RB. Selenium nanoparticles pre-treatment reverse behavioral, oxidative damage, neuronal loss and neurochemical alterations in pentylenetetrazole-induced epileptic seizures in mice. International Journal of Nanomedicine. 2020;15:6339. DOI: 10.2147/IJN.S259134.

[64] Ren SX, Zhang B, Lin Y, Ma DS, Yan H. Selenium nanoparticles dispersed in phytochemical exert anti-inflammatory activity by modulating catalase, GPx1, and COX-2 gene expression in a rheumatoid arthritis rat model. Medical science monitor: international medical journal of experimental and clinical research. 2019;25:991.

DOI: 10.12659/MSM.912545.

http://annalsofrscb.ro 17062

[65] Zoidis E, Pappas AC, Georgiou CA, Komaitis Ε, Feggeros K. Selenium affects the expression of GPx4 and catalase in the liver of chicken. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology. 2010 Mar 1;155(3):294-300.

DOI: 10.1016/j.cbpb.2009.11.017.

[66] Amin KA, Hashem KS, Alshehri FS, Awad ST, Hassan MS. Antioxidant and hepatoprotective efficiency of selenium nanoparticles against acetaminophen-induced hepatic damage. Biological trace element research. 2017 Jan 1;175(1):136-45. DOI: 10.1007/s12011- 016-0748-6.

[67] Suthar PC. Glutathione S-Transferases: A brief on classification and GSTM1-T1 activity.

International Journal of Pharmaceutical Sciences and Research. 2017 Mar 1;8(3):1023. DOI:

10.13040/IJPSR.0975-8232.8(3).1023-27.

[68] El‑Terras A, Soliman MM, Alkhedaide A, Attia HF, Alharthy A, Banaja AE.

Carbonated soft drinks induce oxidative stress and alter the expression of certain genes in the brains of Wistar rats. Molecular medicine reports. 2016 Apr 1;13(4):3147-54.

DOI: 10.3892/mmr.2016.4903.

[69] Handa N, Kohli SK, Sharma A, Thukral AK, Bhardwaj R, Abd_Allah EF, Alqarawi AA, Ahmad P. Selenium modulates dynamics of antioxidativedefence expression, photosynthetic attributes and secondary metabolites to mitigate chromium toxicity in Brassica juncea L.

plants. Environmental and Experimental Botany. 2019 May 1;161:180- 92.https://doi.org/10.1016/j.envexpbot.2018.11.009.

[70] Jahdahunsi ,K. A., Adebisi .,A. K., Chinedu .,I and Yohan.,A. Effects of Administering Soft Drinks on Some Biochemical Parameters and Histopathology of Liver in Wistar Rats.

International Journal of Medical Science and Dental Research. 2018 August 1(1):11-19.

[71] Abid A, Taha O, Nseir W, Farah R, Grosovski M, Assy N. Soft drink consumption is associated with fatty liver disease independent of metabolic syndrome. Journal of hepatology.

2009 Nov 1;51(5):918-24. DOI: 10.1016/j.jhep.2009.05.033.

[72] Radwan RR, Shaban EA, Kenawy SA. Hepatoprotective Efficiency of Combined Administration of Natural Antioxidants (Rutin and Vitamin E) and Cysteine in Hyperthermic Irradiated Rats. Egyptian Journal of Hospital Medicine. 2008 Sep 1;32:441-454.

[73] Abou Zaid OA, Abd El-hamid OM, El-Refaey SA. Biochemical alterations of Chitosan on Liver function tests and Immunoglobulin in Experimental induced Non Alcoholic Fatty Liver Disease in Rats. International Journal of Pharma Sciences. 2017 June 7(3):1794-98.

[74] Wang ZF, Wang MY, Yu DH, Zhao Y, Xu HM, Zhong S, Sun WY, He YF, Niu JQ, Gao PJ, Li HJ. Therapeutic effect of chitosan on CCl4‑induced hepatic fibrosis in rats. Molecular medicine reports. 2018 Sep 1;18(3):3211-8. DOI: 10.3892/mmr.2018.9343.

[75] El-Denshary ES, Aljawish A, El-Nekeety AA, Hassan NS, Saleh RH, Rihn BH, Abdel- Wahhab MA. Possible synergistic effect and antioxidant properties of chitosan nanoparticles and quercetin against carbon tetrachloride-induce hepatotoxicity in rats. Soft Nanoscience Letters. 2015 April ;5(2):36-51. DOI:10.4236/snl.2015.52005.

[76] Al-Eisa RA. Synergistic antioxidant capacity of chitosan nanoparticles and lycopene against aging hepatotoxicity induced by D-galactose in male rats. International Journal of Pharmacology. 2018 Jan 1;14(6):811-25. DOI: 10.3923/ijp.2018.811.825.

[77] Rotruck JT, Pope AL, Ganther HE, Swanson AB, Hafeman DG, Hoekstra W. Selenium:

biochemical role as a component of glutathione peroxidase. Science. 1973 Feb 9;179(4073):588-90. DOI: 10.1126/science.179.4073.588

[78] Burk RF, Hill KE, Awad JA, Morrow JD, Lyons PR. Liver and kidney necrosis in selenium-deficient rats depleted of glutathione. Laboratory investigation; a journal of technical methods and pathology. 1995 Jun 1;72(6):723-30. PMID: 7783430.

http://annalsofrscb.ro 17063

[79] Brigelius-Flohé R, Maiorino M. Glutathione peroxidases. Biochimica et BiophysicaActa

(BBA)-General Subjects. 2013 May 1;1830(5):3289-303.

DOI: 10.1016/j.bbagen.2012.11.020.

[80] Horky P, Ruttkay-Nedecky B, Nejdl L, Richtera L, Cernei N, Pohanka M, Kopel P, Skladanka J, Hloucalova P, Slama P, Nevrkla P. Electrochemical methods for study of influence of selenium nanoparticles on antioxidant status of rats. International Journal of Electrochemical Science. 2016 Apr 1;11(4):2799-824.