18448
Potential Misidentification of Methicillin Resistant S. Aureus based on Nuc- Specific PCR.
Khairallah AS Mohammed, Zahraa H Abdulkareem and Amel K Yaqoob
Department of Medical Lab Technology, College of Health and Medical Technology, Southern Technical University, Basrah / Iraq
Corresponding author;
Khairallah A S Mohammed Telephone number: +964 781 752 1597
Abstract
PCR based on amplification of nuc gene (encoding staphylococcal thermostable nuclease) is considered as a reliable method for identification of MRSA strains. The aim of this study was to evaluate the efficiency of nuc-specific PCR as the sole molecular method for identification of MRSA. Sixty MRSA strains isolated from clinical samples from outpatients were identified phenotypically and subject to PCR for detecting mecA and 16S rRNA genes. Then, all isolates were subjected to PCR to detect two different regions of nuc gene (270 bp and 430 bp).
Resistance to methicillin was investigated by cefoxitin disk diffusion test. The results showed that all tested strains were resistant to cefoxitin and positive for mecA and 16S rRNA genes. Out of 60 isolates, 58 strains exhibited amplification of 423bp and 55 strains showed amplification of 270 bp product of nuc gene. The five strains (8.3%) which failed to amplify 270bp were positive for 423bp product of nuc gene and the two strains (3.3%) which failed to amplify 423bp were positive for 270bp region. The discrepancies between the results indicated that the nuc-specific PCR method is not sufficient alone. Therefore, combination of other species-specific target would be useful to avoid potential false negative results.
Key Words: PCR, nuc gene, methicillin-resistant Staphylococcus aureus, misidentification
Introduction
Increasing the prevalence rate of methicillin resistant S. aureus (MRSA) among inpatients and community led to a dramatic economic problem and concerns in the public health due to limited options of treatment of MRSA infections (Mathews et al. 2010). Hence, the rapid, sensitive and specific diagnostic method is very important in treating and controlling the spread of MRSA infections. Different PCR-based approaches have been employed for the rapid detection of S.
aureus. Amplification of selected fragments of nuc gene was frequently used to detect and
identify MRSA (Louie et al. 2002, Maes et al. 2002). Nuc gene encodes an extracellular thermostable nuclease, which is one of the most unique and successful characteristics that might be used to differentiate S. aureus from another staphylococcus spp. (Louie et al. 2002, Maes et al. 2002). This suggests that nuc gene is a specific target and PCR is an appropriate method for identifying this gene in S. aureus. Brakstad et al. (1992) reported that the nuc gene has potential for the rapid diagnosis of S. aureus infections by direct testing of clinical specimens, based on amplification product of nuc gene at 279 bp region for all 90 of 90 clinical isolates of S. aureus.
David et al. (2010), stated that PCR amplification of the nuc gene (∼270 bp) is considered as a gold standard method for identifying of S. aureus. Furthermore, Sahebnasagh et al. (2014), reported that the nuc gene is more specific than the 16S rRNA gene in detecting S. aureus. Also, Wongboot et al. (2013), Bettin et al. (2012), Kateete et al. (2010) and Amina and Fawziah (2019) reported that the amplification of nuc gene (∼ 423 bp) could be used as a trustworthy diagnostic method to detect S. aureus. The aim of the present study was to evaluate the efficiency of using nuc-specific PCR as the sole molecular method for fast screening and identification of MRSA.
Materials and methods
Bacterial strains and susceptibility test.
A total of 60 S. aureus strains isolated from different clinical specimens were obtained from outpatients in South of Iraq. S. aureus isolates were collected from urine samples, tonsil swabs, nasal swabs, wound swabs, burn swabs, blood samples, and sputum. All strains were identified as S. aureus according to the standard microbiological techniques (Merlino et al. 2000) this identification was also confirmed by PCR using species-specific 16S rRNA primer pairs
(Table 1). MRSA strains were detected by using cefoxitin (30 µg) disk diffusion test and amplification of mecA gene (Skov et al. 2003, Kuroda et al. 2001).
Amplification of 16S rRNA, mecA, and nuc genes
The DNA extraction and amplification of 16S rRNA and mecA was performed as described by our previous study (Mohammed et al. 2021). The extracted DNAs were then subjected to simplex PCR to amplify two fragments of nuc gene (270 bp and 430 bp) by using two different sets of primers targeted this gene (Table 1). The reaction mix contained 2 µl (50-100 ng) DNA, 1 µl (20 pmol) of each primer, 12.5 µl of master mix (Taq DNA polymerase, dNTPs, MgCl2 and reaction buffers; Promega) and 8.5 µl of nuclease free water with had a final volume of 25 µl. A total of 37 PCR cycles were run under the following conditions: DNA denaturation at 94oC for 1 min, an annealing step at 56oC for 1 min and an extension step at 72oC for 2 min, followed by a final extension at 72oC for 10 min. The amplified products were then visualized by agarose gel electrophoresis.
18450 Table 1. Primers used in this study.
Primer Primer sequencing 5’ to 3’ Size (bp) References
16S rRNA F- 5’ GTA GGT GGC AAG CGT TAT CC 3’
R- 5’ CGCACATCAGCGTCAG 3’
228 Geha, et al.
(1994) MecA F- 5’ GTA GAA ATG ACT GAA CGT CCG ATAA 3’
R- 5’ CCA ATT CCA CAT TGT TTC GGT CTAA 3’
310 Monday and
Bohach 1999 nuc P 1
F- 5’ GCTTGCTATGATTGTGGTAGCC 3‘
R- 5’ TCTCTAGCAAGTCCCTTTTCCA 3’
423 Wongboot et al.
2013
nuc p 2 F 5’ GCGATTGATGGTGATACGGTT 3’
R 5’ AGCCAAGCCTTGACGAACTAAAGC 3’
270 Brakstad et al.
1992
Results and discussion
A total of 60 isolates were phenotypically identified as S. aureus. All tested isolates showed positive results for the 16S rRNA and the mecA genes. All tested strains were resistant to cefoxitin. By applying PCR method, among the 60 isolates clinical samples that were identified as MRSA, 58 strains exhibited amplification of 423bp fragment of nuc gene and 55 strains showed amplification of 270 bp fragments of nuc gene (figure 1). The two strains (3.3%) which failed to amplify 423bp fragment of nuc gene were positive for 270bp fragment nuc gene. On other hand, the five strains (8.3%) which failed to amplify 270bp fragment of nuc gene were positive for 270bp fragment of nuc gene (figure 2 - 3). The presence of some discrepancies between the results of using two different sets of primers for detection of S. aureus strains, make it clear that, the method for identification of nuc genes is not sufficient alone. Several studies described PCR based on amplification the nuc gene alone as a fast screening or identification method of methicillin resistant S. aureus (MRSA) (Elsayed et al., 2003; Costa et al., 2005;
Thomas et al., 2007). Brakstad et al. (2002) used the nuc gene as target DNA to identify S.
aureus strains and reported amplification product of nuc gene at 279 bp region for all 100%
clinical isolates of S. aureus tested in their study. Therefore, we used primers of their study in the present project. We found that 8.3% of the tested strains failed to amplify nuc gene and generate false negative results. All tested strains, which failed to amplify 279bp region, succeeded to amplify another region of nuc gene (423 bp) by using different primers. On other hand, other isolates failed to amplify the 423bp region showed positive PCR results for 270bp region of nuc gene. These findings proved that the nuc negative PCR don’t mean the absence of nuc gene in these strains. The present results indicated that nuc specific PCR gene may produce false negative results because of variation in the sequence of the nuc gene among the nuc genes. van Leeuwen et al. (2008) reported that a partial deletion of the nuc gene led to a nuc-negative PCR and false-negative MRSA result. Hoegh et al. (2014) stated that there is a potential misidentification of S. aureus isolates that are negative for the nuc gene on PCR. Accordingly, identification of MRSA based on nuc specific PCR alone may result in misidentification of these
organisms. Therefore, combination of other species-specific target would be useful to cover a wider range of strains and to avoid any potential false negative results. The observed variations in nuc gene among clinical strains suggest that major genetic changes may have taken place.
Hence, further studies are needed to investigate the nature and significance of these changes.
Figure 2. Gel electrophoresis of PCR products of the nuc gene for 4 strains. DNA was amplified using two sets of primers p1 and p2 with expected size (423 and 270 bp). The four isolates give one PCR product (423 bp).
All strains showed positive results for mecA gene (310bp). M, DNA ladder (100 bp); strain 1(lanes 1, 2, 3); strain 2 (lanes 4, 5, 6); strain 3 (lanes 7, 8, 9); strain 4 (lanes 10, 11,12); N: no
amplified product for 270bp fragment.
Figure 1. Gel electrophoresis of PCR products of the nuc gene for 4 representative strains. DNA was amplified using two sets of primers p1 and p2 with expected size (423 and 270 bp). The four isolates give 2 amplified products (423 and 270pb).
All strains showed positive results for mecA gene (310bp). M, DNA ladder (100 bp); strain 1(lanes 1, 2, 3); strain 2 (lanes 4, 5, 6); strain 3 (lanes 7, 8, 9); strain 4 (lanes 10, 11,12).
18452 Figure 3. Gel electrophoresis of PCR products of the nuc gene for 2 strains. DNA was amplified using two sets of primers p1 and p2 with expected size (423 and 270 bp). The two isolates give one PCR product (270 bp).
All strains showed positive results for mecA gene (310bp). M, DNA ladder (100 bp); strain 1(lanes 1, 2, 3); strain 2 (lanes 4, 5, 6); N: no amplified product for 423bp fragment.
Data Availability: The data used to support the findings of this study are available from the corresponding author upon request.
Conflicts of Interest: No conflicts of interest to declare Funding Statement: No funding is associated with this study.
References
1. Amina, S. M., and Fawziah, A. A. (2019). Bacteriological and molecular detection of S.
aureus superantigenic toxin genes in women, cows and buffaloes milk.
Bas.J.Vet.Res.Vol.18, No.1,
2. Bettin, A., Causil, C. and Reyes, N. (2012). Molecular identification and antimicrobial susceptibility of Staphylococcus aureus nasal isolates from medical students in
Cartagena, Colombia. Braz. J. Infect. Dis. 16: 329-334. DOI 10.1016/j. bjid.2012.06.017 3. Brakstad, O. G., Aasbakk, K. and Maeland, J.A. (1992). Detection of Staphylococcus
aureus
4. by polymerase chain reaction amplification of the nuc gene. J. Clin. Microbiol., 30(7):1654-1660.
5. Costa, A. M., Kay, I. & Palladino, S. (2005). Rapid detection of mecA and nuc genes in staphylococci by real-time multiplex polymerase chain reaction. Diagn Microbiol Infect Dis 51, 13–17.
6. David, P. K., Cyrus, N., Fred, A. K., Alfred O, Moses, S. and Ann, N. (2010).
Identification of Staphylococcus aureus: DNase and mannitol salt agar improve the efficiency of the tube coagulase test. Ann. Clin. Microbiol. Antimicrob.; 9: 23.
7. Elsayed, S., Chow, B. L., Hamilton, N. L., Gregson, D. B., Pitout, J. D. & Church, D.
L. (2003). Development and validation of a molecular beacon probe-based real-time polymerase chain reaction assay for rapid detection of methicillin resistance in Staphylococcus aureus. Arch Pathol Lab Med 127, 845–849.
8. Geha, DJ., Uhl, JR., Gustaferro, CA., Persing, DH. (1994). Multiplex PCR for identification of methicillin-resistant staphylococci in the clinical laboratory. J Clin Microbiol., Jul;32(7):1768-72.
9. Hoegh, S. V., Skov, M. N., Boye, K., Worning, P., Jensen, T. G., Kemp, M. (2014).
Variations in the Staphylococcus aureus-specific nuc gene can potentially lead to misidentification of meticillin-susceptible and -resistant S. aureus. J. Med.
Microbiol.Volume 63, Issue 7
10. Kateete, D.P., Kimani, C.N., Katabazi, F.A., Okeng, A., Okee, M.S., Nanteza, A., Joloba, M.L. and Najjuka, F.C. (2010). Identification of Staphylococcus aureus:
DNase and Mannitol salt agar improve the efficiency of the tube coagulase test. Ann.
Clin. Microbiol. Antimicrob. 9: 23. DOI 10.1186/1476-0711-9-23.
11. Kuroda, M., Ohta, T., Uchiyama, I., Baba, T,, Yuzawa, H., Kobayashi, I., Cui, L., Oguchi, A., Aoki, K. I., Nagai, Y. (2001). Whole genome sequencing of meticillin- resistant Staphylococcus aureus. Lancet, 357, 1225–1240.
12. Louie L., Goodfellow, J., Mathieu, P., Glatt, A., Louie, M. & Simor, A. E. (2002).
Rapid detection of methicillin-resistant staphylococci from blood culture bottles by using a multiplex PCR assay. J Clin Microbiol 40, 2786–2790.
13. Maes, N., Magdalena, J., Rottiers, S., De Gheldre, Y. & Struelens, M. J. (2002).
Evaluation of a triplex PCR assay to discriminate Staphylococcus aureus from coagulase- negative staphylococci and determine methicillin resistance from blood cultures. J Clin Microbiol 40, 1514–1517.
14. Mathews, A. A., Thomas M, Appalaraju, B., Jayalakshmi. J. (2010). Evaluation and comparison of tests to detect methicillin resistant Staphylococcus aureus. Indian J Pathol Microbiol., 53(1): 79-82.
15. Merlino, J., Leroi, M., Bradbury, R., Veal, D., Harbour, C., (2000). New chromogenic identification and detection of Staphylococcus aureus and methicillin- resistant S. aureus. J Clin Microbiol. Jun; 38(6): 2378-80.
18454 16. Mohammed A S Khairallah, Abdul Kareem H Zahraa, Alzaalan R Ayoob, Yaqoob K Amel. (2021). Spa typing of Staphylococcus aureus Isolated from Clinical Specimens from Outpatients in Iraq. PJM, Vol.70 , ISSUE 1.
17. Monday, SR. and Bohach, GA. (1999). Use of multiplex PCR to detect classical and newly described pyrogenic toxin genes in Staphylococcal isolates. J Clin Microbiol. vol.
37, no. 10, pp. 3411–3414.
18. Sahebnasagh, R., Saderi, H. and Owlia, P. (2014). The prevalence of resistance to methicillin in Staphylococcus aureus strains isolated from patients by PCR method for detection of mecA and nuc genes. Iran. J. Public Health.43(1): 84–92.
19. Skov, R., Smyth, R., Clausen, M., Larsen. AR., Frimodt-Moller, N., Olssen- Liljequist, B., et al. (2003). Evaluation of a cefoxitin 30 micro disc on Iso-Sensitest agar for detection of methicillin-resistant Staphylococcus aureus. J Antimicrob Chemother.
52(2):204-7.
20. Thomas, L. C., Gidding, H. F., Ginn, A. N., Olma, T. & Iredell, J. (2007).
Development of a real-time Staphylococcus aureus and MRSA (SAM-) PCR for routine blood culture. J Microbiol Methods 68, 296–302.
21. van Leeuwen, W., Roorda, L., Hendriks, W., Francois, P. & Schrenzel, J. (2008). A nucdeficient methicillin-resistant Staphylococcus aureus strain. FEMS Immunol Med Microbiol 54, 157
22. Wongboot, W., Chariya, C., Chulapan, E. and Prajuab, C. (2013). Multiplex PCR for detection of super antigenic toxin genes in methicillin-sensitive and methicillin -resistant Staphylococcus isolated from patients and carriers of a hospital in northeast hail and Southeast Asian J Trop Med Public Health 44.
