Molecular Identification and Phylogenetic Relationships of Threadfin Breams (Family: Nemipteridae ) Using mtDNA Marker

(1)

Molecular Identification and Phylogenetic Relationships of Threadfin Breams (Family: Nemipteridae ) Using mtDNA Marker

Vaithilingam RAVITCHANDIRANE

¹

, Vaithianathan GEETHA

¹

, Vijayan RAMYA

¹

, Bilavendiran JANIFER

¹

, Muthusamy THANGARAJ

²*

, Jayachandran

SUBBURAJ

²

, Vellaichamy RAMANADEVI

²

, Takshnamurthy GANESAN

³

1Kanchi Mamunivar Centre for Post-Graduate Studies, Department of Zoology, 605008 Pondicherry, India

2Annamalai University, Centre of Advanced Study in Marine Biology, 608 502 Parangipettai, Tamilnadu, India; [email protected] (*corresponding author)

3Tagore Arts College, Department of Plant Science, 605008 Pondicherry, India

Abstract

Cytochrome c oxidase-1 gene sequences of mitochondrial genome were analyzed for species identification and phylogenetic relationship among the commercially important Nemipterus species. Sequence analysis of COI gene clearly indicated that all the nine fish species fell into distinct clads, which are genetically distant from each other and exhibited identical phylogenetic reservation. All the COI gene sequences provide sufficient phylogenetic information and evolutionary relationship to distinguish the nine Nemipterus species unambiguously. As per the neighbour-joining (NJ) and maximum likelihood (ML) trees, all the nine species are genetically distant from each other and exhibited identical phylogenetic reservation. Based on the NJ and ML phylogenetic trees N. mesoprion, N.

zysron, N. hexodon, N. nematophorus, N. virgatus and N. bipunctatus were closely related with high bootstrap value (97). The overall mean Kimura two parameter (K2P) distances between the nine species was 0.109. The intra species K2P distance was high in N. japonicus (0.069) followed by N. peronii (0.050) and N. mesoprion (0.002). This study proves the use of mtDNA COI gene sequence based approach is an alternative tool for identifying fish species at a faster pace.

Keywords: cytochrome oxydase-1, intraspecific, Nemipterus, phylogeny; taxonomy

Abbreviation used: mtDNA: mitochondrial DNA, CO1: Cytochrome Oxydase-1, NJ: Neighbour-joining, ML: Maximum Likelihood, K2P: Kimura Two Parameter, FAO: Food and Agricultural Organization, dNTP: Deoxyribonucleotide triphosphate, mM: Milli Molar, TAE: Tis Acetate EDTA

Introduction

The threadfin breams, also called pink perch constitute an important demersal finfish resource in the Indian EEZ.

These fishes are abundant beyond 50 m but show higher concentration at 100-200 m depth as revealed by the exploratory surveys and experimental fishing (Murty et al., 2001). Threadfin breams are one of the most dominant components among the demersal fisheries of India being exploited by commercial trawlers and available all the en- tire year (Russell, 1990). The classification of nemipterid fishes into different taxa is much confusing as, they are the members of one of the most confusing families (Russell, 1990). Threadfin bream’s catches are usually mixed in In- dia with representation of three or more species of genus Nemipterus (Murty et al., 2001). They are rarely reported as separate species because of problems in proper identification (Pawar et al., 2011). Morphometric characters and colour patterns are the most useful taxonomic tools

which helps in segregation of fish species (Russell, 1990).

But taxonomic ambiguity exists for juvenile and pre-adult fishes and it may lead to another synonym to a fish species. DNA-based approaches for taxon diagnosis exploit- ing DNA sequence diversity among species can be used to identify fishes and resolve taxonomic ambiguity including the discovery of new ⁄ cryptic species (Hebert et al., 2003).

As there is no paternal contribution of mtDNA and no known recombination between mitochondrial genomes, the mtDNA genes are selected for species identification (Thangaraj and Lipton, 2011). Earlier studies have dem- onstrated that the COI gene is appropriate and accepted as a universal barcode for discriminating between closely related species across diverse animal phyla and this has been used for marine and freshwater fishes (Hebert et al., 2003; Hubert et al., 2008; Lakra et al., 2011; Ward et al., 2005).

Considering the importance of molecular identification and as there are no attempts to study genetic relation- Received 30 March 2012; accepted 28 April 2012

(2)

ing a UV spectrophotometer. The DNA was diluted in TAE buffer to a final concentration of 100 ng ⁄µL.

Amplification and sequencing

The COI gene was amplified in a 50 µL volume with 5 µL of 10X Taq polymerase buffer, 2 µL of MgCl₂ (50 mM), 0.25 µL of each dNTP (0.05 mM), 0.5 µL of each primer (0.01 mM), 0.6 U of Taq polymerase and 5 µl of genomic DNA. The primers used for the amplification of the COI gene were FishF1- 5’TCAACCAACCACAAAGACATTGGCAC3’ and FishR1-5’TAGACTTC TGGGTGGCCAAAGAAT- CA3’ (Ward et al., 2005). The thermal regime consisted of an initial step of 2 min at 95°C followed by 35 cycles of 40 s at 94°C, 40 s at 54°C and 1 min 10 s at 72°C followed in turn by final extension of 10 min at 72°C.

The PCR products were visualized on 1.5% agarose gels, and the most intense products were selected for sequencing. The cleaned up PCR product was sequenced by a sequencing facility (Bioserv Biotechnologies Pvt Ltd, Hyderabad, India).

Sequence analysis

The CO1 gene partial sequences of the four Nemipter- us species were unambiguously edited using BioEdit se- quence alignment editor14 and aligned using CLUSTAL- W in BioEdit, and checked manually. Identical sequences were assigned in the same haplotype identity and only a single example of each species used in the phylogenetic divergences assuming that identical haplotypes shared the ship between various Nemipterus species, in spite of its

economic importance and significant contribution in marine fishery, the present study was achieved. In this study, the genetic difference between four commonly available threadfin bream species in Bay of Bengal and other Ne- mipterus species were assessed using mitochondrial gene sequence.

Materials and methods Sample collection

Forty specimens from four species were collected from the Pondicherry coastal waters (11°46’ and 12°03’ N and 79°36’ and 79°53’ E). Immediately after the collection specimens were kept in the iceboxes for further studies. All the fishes were identified up to the species level using the FAO Fish Identification Sheets (Thomson, 1984) and further confirmation were carried out at Zoological Survey of India, Southern Regional Centre, Chennai. The voucher specimens are maintained in the Department of Zoology, Kanchi Mamunivar Centre for Post-Graduate Studies, Pondicherry. Approximately 100 mg of white muscle tis- sue and fin-clips from two to five individuals of each species were preserved in 95% ethanol and stored at 4°C until used.

DNA isolation

The DNA was isolated by standard Proteinase-K/Phe- nol-Chloroform-ethanol method (Sambrook et al., 1989) and the concentration of isolated DNA was estimated us-

Tab. 1. Threadfin bream fish species and their COI sequence Genbank accession numbers

Sl. No Scientific name Common name Accession number

1 Nemipterus zysron Slender threadfin bream JN992287.1

2 Nemipterus nematophorus Doublewhip threadfin bream JN992286.1

3 Nemipterus bipunctatus Delagoa threadfin bream HQ423413.1

4 Nemipterus hexodon Ornate threadfin bream EF609414.1

5 Nemipterus furcosus Fork-tailed threadfin bream EF609413.1

6 Nemipterus japonicus 1 Japanese threadfin bream FJ347947.1

7 Nemipterus japonicus 2 Japanese threadfin bream EF609555.1

8 Nemipterus japonicus 3 Japanese threadfin bream EF609553.1

9 Nemipterus japonicus 4 Japanese threadfin bream HQ149889.1

10 Nemipterus japonicus 5 Japanese threadfin bream JN992288.1

11 Nemipterus mesoprion 1 Mauvelip threadfin bream EF609561.1

15 Nemipterus virgatus 1 Golden threadfin bream FJ237835.1

19 Nemipterus peronii 1 Notchedfin threadfin bream EF609415.1

20 Nemipterus peronii 2 Notchedfin threadfin bream HQ149890.1

21 Nemipterus peronii 3 Notchedfin threadfin bream HQ149891.1

22 Lates calcarifer (Outgroup) Seabass EU189376.1

(3)

same evolutionary origin. Haplotype definitions have been submitted to the NCBI GenBank (Acc. No. HQ423413, JN992286, JN992287, JN992288). To support the present data, selective CO1 sequences in other five Nemipterus species and one outgroup (Lates calcarifer) were retrieved from Genbank (Tab. 1). Nucleotide diversity, genetic variation and nucleotide composition and pairwise evolutionary distance among haplotypes was determined by the Kimura 2-Parameter method (Kimura, 1980) using the software program MEGA 3.1 (Molecular Evolutionary Genetics Analysis) (Kumar et al., 2004). The neighbour- joining (NJ) and maximum likelihood (ML) trees were constructed using MEGA 3.1 and to verify the robustness of the internal nodes of these trees, bootstrap analysis was carried out using 1000 pseudoreplications.

Results and discussion

A total of 21 sequences were analysed from nine Nem- ipterus species in this study. Simplicity and un-ambiguity were observed among all the sequences and no introns, de- letions or stop codons were observed any of the sequences.

The sequence analysis revealed the average nucleotide fre- quencies as A = 23.4 ± 0.75%, T = 31.6 ± 1.17%, G = 18.0

± 0.60, C = 26.9 ± 0.76 (Tab. 2). The average number of nucleotide difference (K) = 67.51 and nucleotide diversity (Pi) = 0.1342. Tajma’s statistics (D) =-0.1109 and it was not significantly (p<0.01) different among sequences.

Kimura 2 Parameter (K2P) genetic distance in thread-

fin bream fish species is given in Tab. 3. The overall K2P distance between the nine species was 0.109. The K2P genetic distance was high (0.150) between N. perinii and N. hexodon. Very low K2P distance (0.009) was exhibited between N. mesoprion and N. zysron.

The intra-species K2P distance (Fig. 1) was high in N.

japonicus (0.069) followed by N. peronii (0.050) and N.

mesoprion (0.002). The codon based genetic distance in nine Nemipterus species is depicted in Tab. 4 (below diagonal). Based on the CO1 sequence data, the codon based genetic distance was high (0.372) between N. hexodon and N. nematophorus. The minimum level (0.007) of codon based genetic distance was displayed between N. mesopri-

Tab. 2. Nucleotide base composition of threadfin bream fish species

Species A T G C GC GC 1 GC2 GC3

N. zysron 23.6 32.2 17.1 27.2 44.3 36.1 54.1 42.4

N. nematophorus 25.0 33.2 16.3 25.5 41.8 30.7 53.2 41.5

N. bipunctatus 23.7 32.3 18.6 25.4 44.0 33.8 54.9 43.4

N. hexodon 24.3 30.5 18.2 27.0 45.2 38.4 54.6 42.7

N. furcosus 23.4 29.8 17.9 29.0 46.9 42.0 56.0 42.7

N. japonicus 23.1 32.4 17.8 26.8 44.7 35.4 56.4 42.7

N. mesoprion 22.7 32.7 18.4 26.2 44.6 36.2 55.1 42.7

N. virgatus 23.6 31.1 18.1 27.1 45.2 39.5 54.4 42.8

N. peronii 24.1 30.0 18.3 27.6 46.3 39.2 56.3 42.9

Mean 23.4 ± 0.75 31.6 ± 1.17 18.0 ± 0.60 26.9 ± 0.79 44.7 ±1.45 36.8 ± 3.38 55.0 ± 1.07 42.64 ± 0.50 Fig. 1. Intra-species Kimura 2 Parameter (K2P) genetic distance in threadfin bream fish species

Tab. 3. Kimura 2 Parameter (K2P) genetic distance in threadfin bream fish species

Species N.

zysron N.

nematophorus N.

bipunctatus N.

hexodon N.

furcosus N.

japonicus N.

mesoprion N.

virgatus N.

peronii

N. zysron ****

N. nematophorus 0.075 ****

N. bipunctatus 0.099 0.095 ****

N. hexodon 0.078 0.100 0.098 ****

N. furcosus 0.133 0.140 0.122 0.142 ****

N. japonicus 0.133 0.133 0.141 0.138 0.122 ****

N. mesoprion 0.009 0.076 0.093 0.069 0.134 0.130 ****

N. virgatus 0.086 0.079 0.090 0.095 0.114 0.123 0.084 ****

N. peronii 0.145 0.144 0.141 0.150 0.064 0.120 0.140 0.134 ****

(4)

created to provide a graphical representation of the pat- terning of divergence of nine Nemipterus species (Fig. 2 and 3). As per NJ tree two distinct clads as two sub-trees within the same genus were recognized with high bootstrap value. Among the two sub-trees the larger one has an independent assemblage of N. mesoprion, N. zysron, N.

hexodon, N. nematophorus, N. virgatus and N. bipunctatus on and N. zysron. The disparity index in nine Nemipterus

species is displayed in Tab. 4 (above diagonal). The maximum disparity index (0.249) was observed between N.

nematophorus and N. hexodon.

All the twenty two sequences were subjected in the phylogenetic analysis. The neighbour joining tree (NJ) and maximum likelihood tree (ML) of K2P distance were

Tab. 4. Codon based distance (below diagonal) and disparity index (above diagonal) in threadfin bream fish species

Species N.

zysron N.

nematophorus N.

bipunctatus N.

hexodon N.

furcosus N.

japonicus N.

mesoprion N.

virgatus N.

peronii

N. zysron **** 0.161 0.107 0.085 0.000 0.000 0.000 0.000 0.011

N. nematophorus 0.256 **** 0.000 0.249 0.099 0.000 0.172 0.121 0.020

N. bipunctatus 0.231 0.030 **** 0.171 0.087 0.000 0.121 0.082 0.000

N. hexodon 0.185 0.372 0.292 **** 0.000 0.050 0.158 0.000 0.000

N. furcosus 0.093 0.262 0.233 0.030 **** 0.000 0.000 0.000 0.005

N. japonicus 0.075 0.060 0.060 0.206 0.111 **** 0.000 0.000 0.000

N. mesoprion 0.007 0.268 0.238 0.247 0.145 0.087 **** 0.000 0.024

N. virgatus 0.044 0.221 0.195 0.062 0.010 0.070 0.081 **** 0.000

N. peronii 0.126 0.166 0.102 0.066 0.056 0.076 0.159 0.053 ****

Fig. 2. Neighbour Joining (NJ) phylogenetic tree of threadfin bream fish species from COI gene sequences

(5)

also reported very low within species genetic distance for Indian carangid fishes.

Ward et al. (2005) reported an overall higher GC content in fishes based on complete MtDNA genome ranging from 38.4-43.2% and in CO1 alone it was 42.2-47.1%, which reflects the 3^rd base variation. Peris et al. (2009) also reported considerable variation was exhibited in carangids in the 3^rd base position. In this study it has been observed the mean GC content was 36.8 (GC1)-42.6 (GC3) among the nine Nemipterus species. The range of K2P intra-specific genetic distance in the present study was 0.000-0.069, which was slightly higher when compared with the previous studies of Indian carangids, 0.000-0.015 (Peris et al., 2009), Australian fishes (Ward et al., 2005), North American Birds (Hebert et al., 2004), Moths (He- bert et al., 2003), and Primates (Hajibabaei et al., 2006).

The mean nucleotide diversity (Pi) among all the species was estimated as 0.1342. In earlier studies it was estimated as 0.2029 in Indian marine fishes (Lakra et al., 2011). It has been shown that lineage diversity more quickly within species than between species (Pons et al., 2006).

An effective DNA-based identification system requires the satisfaction of three important conditions: it must be possible to recover the target DNA from all the species;

the sequence information must be easily analysed; and the information content of the target sequence must be suf- with 97% bootstrap value. Another clad representing all

the other three species such as N. japonicus, N. furcosus and N. peronii with only 44% bootstrap value. The outgroup, Lates calcarifer was highly divergent and deviated in to a separate clad forming the root to the phylogenetic tree.

The ML tree also showed the same type of divergence and formed two sub-trees having the bootstrap value of 92%

and 36% respectively.

Species identification and phylogenetic relationship based on traditional methods and molecular methods are mostly concordant (Ward et al., 2005). In this study nine Nemipterus species were found genetically distinct from each other based on CO1 gene sequence which demon- strates simplicity and unambiguity. Morphologically very similar species like N. mesoprion, N. zysron and N. virgatus form a sister clad. Whereas, N. japonicus, N. furcosus and N. peronii form an independent sister clad in both NJ and ML trees of CO1 gene sequence. Estimates of genetic divergence from CO1 gene were sufficient to differentiate individuals of different threadfin bream species. In this study the level of intra-species variation was low which may be due to low number of haplotype identified in the sample with limited numbers collected for this study. Sim- ilarly, Lakra et al. (2011) reported very low intra-specific genetic divergence for scombroid fished and Ward et al.

(2005) in many marine teleost species. Peris et al. (2009)

Fig. 3. Maximum likelihood (ML) phylogenetic tree of threadfin bream fish species from COI gene sequences

(6)

Kimura M (1980). A simple method of estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. J Molec Evol 16:111-120.

Kumar S, Tamura K, Nei M (2004). MEGA3: Integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief Bioinfo 5:150-163.

Lakra WS, Verma MS, Goswami M, Lal KK, Mohindra V, Punia P, Gopalakrishnan A, Singh K V, Ward RD, Hebert P (2011). DNA barcoding Indian marine fishes. Mol Ecol Res 11: 60-71.

Murthy VS, Vivekanandan E, Zacharia PU, Joshi KK, Manojkumar PP, Nair KVS, Gandhi V, Rajkumar U, Shoba, Kizhakundan J (2001). Development of management strategies for sustainable fishery of Threadin breams and silverbellies. CMFRI Ann Rep 37-39 p.

Pawar HB, Shirdhankar MM, Barvae SK, Patange SB (2011).

Discrimination of Nemipterus japonicus (Bloch, 1791) stock from Maharashtra and Goa states of India. Ind J Geo Mar Sci 40(3): 471-475.

Peris M, Chandra Sekhar Reddy A, Rao LM, Khedkar GD, Ravinder K, Nasruddin K (2009). COI (Cytochrome oxidase-I) sequence based studies of Carangid fishes from Kakinada coast, India. Mol Biol Rep 36:1733-1740.

Pons J, Barraclough TG, Gomez-Zurita J, Cardoso A, Duran DP (2006). Sequence-based species delimitation for the DNA taxonomy of undescribed insects. System Biol 55:595-606 Russell BC (1990). Nemipterid fishes of the world, FAO

Publications, Rome, 149 p.

Sambrook J, Fritsch EF, Maniatis T (1989). Molecular cloning:

a laboratory manual, 2^nd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

Thangaraj M, Lipton AP (2011). Assessment of genetic variation in closely related seahorse species (Genus: Hippocampus) using mtDNA marker. Ind J Biotech 10:140-142.

Thomson JM (1984). In FAO species identification sheets for fishery purpose, Western Indian Ocean fishing area. Fisher, W and Bianchi G (Eds.). FAO, Rome, Vol. 3.

Ward RD, Zemlac TC, Innes BH, Last PR, Hebert PDN (2005).

DNA barcoding Australia’s fish species. Philosoph Transact Royal Soc B, 360:1847-1857.

ficient to enable species-level identification (Peris et al., 2009). All these three requirements were met in the present study, as all fish species examined could be recovered and targeted CO1 fragment aligned and analysed easily.

Specimens of all species formed distinctive cluster and congruent with conventional morphological taxonomy.

As per Ward et al. (2005), the CO1 analysis seeks only to delineate species boundaries yet there is some clear phylogenetic signal in CO1 sequence data, which is evident by the clustering of most of congeneric and confamilial species. The absolute clustering of conspecifics in the present study indicates the diagnostic ability of CO1 to correctly identify species.

Conclusions

The study has successfully proved the utility of COI divergences in identifying many of the Nemipterid fishes.

The present analysis was not meant to be exhaustive, but to highlight the most important feature of COI based studies, that is the diagnostic ability of COI sequences in distinguishing closely related species and the intra-specific distances are lower than the inter-specific distances which was proved beyond doubt. The slight difference in the res- olution factor in the present study and previous studies on Indian, Australian fishes and other groups of animals may be due to the low sample size. Further studies involving all the threadfin breams in the world and also by increasing the sample size in future studies will clarify the issue.

References

Hajibabaei M, Gregory A, Singer C, Hickey DA (2006).

Benchmarking DNA barcodes: an assessment using available primate sequences. Genome 49:851-854

Hebert PDN, Cywinska A, Ball SL, Ward JR (2003). Biological identifications through DNA barcodes. Proc Royal Soc London, Ser B 270:313-322.

Hebert PDN, Penton EH, Burns JM, Janzen DH, Hallwachs W (2004). Ten species in one: DNA barcoding reveals cryptic species in the neotropical skipper butterfly Astraptes fulgerator. Proc Natl Acad Sci USA 101:14812-14817.

Hubert N, Hanner R, Holm E, Mandrak NE, Taylor E (2008).

Identifying Canadian freshwater fishes through DNA barcodes. PLoS ONE 3(6):e2490.