Effect of the Bone Marrow Mesenchymal Stem Cells on the Wound Healing Mediators of the Full Thickness Scald Injury
Doaa Ramadan I. Abdel-Gawad
1*, WalaaAMoselhy
2, RashaRashad Ahmed
3,Khaled Abbas HelmyAbdou
41,2,4Toxicologyand Forensic Medicine Department, Faculty of Veterinary Medicine,Beni- Suef University,Beni-Suef,Egypt
3Zoology Department, Faculty of Science, Beni-Suef University, Beni-Suef, Egypt
ABSTRACT
Full thickness thermal injury causing severe tissue destruction resulting in excess scarring and disfigurements, so its therapy represents agreat challenge.The severity of this type of wounds could be ameliorated through controlling the wound healing mediators which could be achieved through using of bone marrow mesenchymal stem cells (BM-MSCs) as a type of regenerative therapy. 90 albino rats were divided into 3groups; group I (control), group II (scald model) the animals were exposed to water at 100c for 10 sec under anesthesia, and group III (the scalded animals subcutaneously injected with BM- MSCs (2×106 cells/ mL),they were clinically observed and sacrificed at different time intervals and skin samples were collected for histopathologicalexamination, and determiningthe expression rate of different wound healing mediators via quantitative polymerase chain reaction (qPCR). Therapy with BM-MSCs leading to significant down regulation of interleukin-6 (IL-6), tumer necrotic factor-α (TNF-α), metalloproteinase-9 (MMP-9), andmicroRNA-21 (miR-21),and marked up-regulation of transforming growth factor-β (TGF-β), andheat shock protein-90α(HSP-90α) specially in late stage, whilst the inflammatory cells and the scab were still detected until 14 day post treatment.
In conclusion: BM-MSCs have the ability to regulate the expression rate of the mediators that incorporated in the healing process of full thickness scald and enhancing the wound to progress to the inflammatory phase not to return to the chronic phase.
Key words
BM-MSCs; Full thickness scald; Histopathological;qPCR; Inflammatory mediators;Metalloproteinase-9;microRNA-21;heat shock protein-90α
Introduction
Skin damage from hot liquids exposure usually hot water (Knight, 1996) or molten rubber, tar, oil, liquid chemicals, hot gases, or steam called scald (Wohlseinet al., 2016). Owing to the long recovery period of scald injuries, they consider one of the most expensive traumatic injuries (Sánchez et al., 2007),Death from scald may be occur in all ages, but very young people and elderly are at a higher risk than other age groups (Marshall, 1998), whereas 7%
TBSA scald may lead to 22% mortality (Alden et al. 2007). In severe cutaneous burn injury, the natural healing process and the endogenous source of SCs in the basal layer are scanty for ideal repairing the extensive deep damage (Kanji and Das, 2017).
Treating of burns via cells has been established in 1975 via Green, starting with epithelial autografts and followed by dermal and dermal-epidermal bio-engineered cultured skin substitutes till emerging of SCs (Leclerc et al., 2011).
Introduction of SCs in the cellular therapy aims to mediation of the cellular replacement and protection, adjusting the microenvironment of the injury and enhancing the self-regenerative and reparative processes (Patiet al., 2015).
Treatment of burn injury with iPSCs, allogeneic MSCs or immunomodulatory T-cells causing modulation of the post-burn immunosuppression, hypermetabolic response, and ARDS (Butler et al., 2010).
Primarily, BM-MSCs and embryonic fibroblasts have been used to treat burn injury in rats, in which BM-MSCs caused significant reduction in the wound cellular infiltration and enhancing new blood vessels and granulation tissue genesis than the embryonic fibroblasts (Shumakovet al., 2003). MSCs have the ability to mingle with sebaceous glands, blood vessels, and hair follicles of skin after their engraftment into injuries (Lewis, 2013), helping in wound bed reconstruction and regulation of tissue repair (Dash et al., 2009).
In relation to the affected layers of skin from the applied heat, severity of burns is categorized into different degrees ranging from first to forth degree (Merck and Miller, 2013), in which the developed lesions vary from mild erythema to severe necrosis (Munro and Munro, 2008).The current study aims to determine the efficiency of BM- MSCS in treating the full thickness scald in a rat model.
2. Material and methods 2.1. Chemicals:
DMEM (Dulbecco’s modified Eagle’s medium), Fetal bovine serum (FBS), penicillin streptomycin solution, and trypsin/EDTA, were purchased from Lonza, Belgium. Sodium hydrogen carbonate was purchased from LOBA Chemie, India. Culture consumables and culture flasks were purchased from Greiner Bio-One (Germany).
2.2. Isolation of BM-MSCs:
2.2.1. Preparation of complete culture medium:
According to Sun et al. (2007) solution of penicillin streptomycin, FBS, and sodium hydrogen carbonate were added to 89% DMEM for preparation of the complete medium.
2.2.2. Isolation and culture of BM-MSCs:
For isolation,4-6 weeks old male albino rats were sacrificed via decapitation, followed by complete sterilization of the whole body surface through spraying ethyl alcohol (70%), then the tibiae and femurs bones were dissected out and the whole surrounding tissue removed. Under complete a septic conditions in a Biobase vertical laminar flow cabinet (Biobase, Model: BBS V1300; NO-51, South Gongye Road, Jinan, Shandong Province, China), the epiphysis of the previous dissected bones was cut off just below the growth plate by using sterile fine scissors, for harvesting of the cells, the bone marrow was flushed with DMEM, and the solution was collected in a Falcon tube (15 mL), which centrifuged for 5 min at 3000 rpm for dislodgement and separation of the cells, the supernatant was discarded and the cell pellet was washed with phosphate buffer saline (PBS) rapidly, and suspended in the previously prepared complete culture medium. The viable and dead cells were counted post staining with trypan blue solution (0.2%) which detect the viability of the cells, counting were done via the hemocytometer at 100X magnification (the number of the viable cells was relative to the total number of the cells).
In T-25 cm2 sterile Greiner cell culture flasks with canted neck, 2.5× 106 cells were seeded at the cell density of 1 × 106 cells/ cm2 area, then placed in 5% CO2-humidified incubator (Biobase, Model: BJPX-C50; South Gongye Road, Jinan, Shandong Province, China) at 37°C. Floating and non-adherent cells, as well as dead cells, were removed after 4 days from incubation, and through 7-10 days of culturing and incubation, the adherent cells were washed twice with sterile PBS (pre-warmed at 37°C), and trypsinized with 1 to 2 mL of trypsin (0.25%)/EDTA (1 mM) (pre-warmed at 37°C) for 2-3 min. The detachment of the adherent cells was warranted via examiningthe cells under an inverted biological microscope (Novel, Model: NIB-100; Jiangsu, China). Adding 3-5 ml complete culture medium for stopping the action of trypsin, which followed by collection of cells and centrifugation for 5 min at 3000 rpm, the cells were re-suspended in the culture medium after washing two times an incomplete DMEM. After that the cells were counted and viability was assessed by adding of an equal volume of trypan blue (0.2%).The procedures of isolation and culturing were done according to Chaudhary and Rath. (2017) with some modifications.
2.3. Animals:
Ninety healthy male albino rats (Rattusnorvegicus), about 100-150 g, were used. Animals were maintained under observation for about 7 days, for ensuring the absence of to any infections. In animal house department, the animalswere housed in plastic cages covered with stainless steel cover, at normal temperature, with enough food and water ad-libitum. All animal procedures were conducted according to the standards set forth guidelines for the care and use of the experimental animals by the Animal Ethics Committee of Zoology Department,Faculty of Science,
Beni-Suef University (Approval number is BSU/FS/020-110).
2.4. Experimental design:
Animals were divided into 3 groups (6 animals /time interval) as follows: Group I (control group) animals were not exposed to burn. Group II (scald group) Rats were anesthetized by intraperitoneal (IP) injection of (80 to 100 mg/kg) ketamine and (12 to 10 mg/kg) xylazine, and hair of the dorsal abdominal area was removed using hair removal cream. For induction of a full thickness scald wound, the animal's back was immersed in water at 100°C for 10 sec which covering 20% TBSA. Immediately after scald injury, the animals were IP resuscitated with saline (50 mL/kg) (Yang et al., 2012).Group III (scalded animals treated with BM-MSCs), the isolated BM-MSCs were suspended in an incomplete DMEM with viability greater than 95% and rapidly injected subcutaneouslyin the burned animals at a dose of (2 × 106 cells/mL) (Revilla et al., 2018).The clinical course of skin lesions was evaluated for 14 sequential days. The wound retraction was determined using a caliper in the tested time intervals. Wound contraction was expressed as reduction in percentage of original wound size through using the following formula
The Contracture rate = wound size in the specific day /wound size in the original state × 100% (Galianoet al., 2004).
At the end of each tested time intervals (zero, 2, 6, 12 &24hr, 7 and 14 day),animals underwent anesthesia via a mixture of alcohol, chloroform, and ether (ACE) for sacrification, thenskin samples were collected , which immediately divided into two parts, in which parts of 1 mm3 thick were fixed in 10% neutral buffered formalin for 24 hr, and then transferred into 70% ethyl alc. to carry out the histopathologicalexamination, while others were immediately snap frozen in liquid nitrogen and then preserved under -80oC for determining the expression rate of variable wound healing mediators.
2.5.Histopathological examination:
The fixed skin specimens were dehydrated, embedded in paraffin wax, sectioned at 5 μm, and stained with hematoxylin and eosin (H&E) (Bancroft and Gamble 2002).
2.6. Quantitative assay of the m-RNA levels of the pro-inflammatory cytokines (IL-6 and TNF-α) and TGF-β genes via Polymerase chain reaction (PCR):
Total RNA was extracted via the RNA easy Extraction Kit (Qiagen) according to the manufacturer’s instructions.
Both yield and purity were assessed at 260 and 280 nm respectively using Nano drop ND-2000 spectrophotometer (Thermo Electrom). A total amount of 1 ug RNA was used for cDNA synthesis by Viva 2- steps RT-PCR Kit according to the manufacturer’s guidelines. Quantitative PCR using Thermo Scientific Verso 1-Step RT-PCR Ready-Mix kit (Applied Bio systems, Foster City, CA, USA) was performed to analyze the mRNA rate of the target genes. The primers used for amplification were as follows:
B-actin,
F: 5- d TCCCTGAAGTACCCCATGGAG-3′, R: 5′- d TTGGCCTTGGGGTTCAGGGGG-3, IL-6
F: 5′-GCCT TCTTGGGACTGATG-3, R: 5′-TGGTCTGTTGTGGGTGGT-3´, TNFα
F: 5′-GCTGAGGTTGGACGGATAAA-3′, R: 5′-AAAATCCTGCCCTGTCACAC -3′,
and TGF-β F: 5́ -TGGCGTTACC TTGGTAACC- 3´, R: 5́ - GGTGTTGAGCCCTTTCCAG- 3´
2.7. Quantitative assay of the m-RNA levels of HSP-90α, MMP-9, and miR-21 genes via Quantitative Real time-PCR (RT-qPCR):
RNA was extracted via nucleic acid extraction kit (NucleoSpin®) purchased from Macherey- Nagel GmbH & Co.
KG- Germany (REF 740955.50) according to the manufacturer’s protocol. The purity (A260/A280 ratio) and the RNA concentration were obtained using spectrophotometry (dual wave length Beckman, Spectrophotometer, USA).cDNA Synthesis viaVivantis, ViPrimePLUS One Step Taq RT-qPCR Green Master Mix I with ROX (SYBR Green Dye) (cat no #QLMM14-R) kit according to the manufacturer’s protocol.The prepared reaction mix samples were applied in real time PCR (Step One Applied Biosystem, Foster city, USA) was done to analyze the mRNA expression rate of the target genes. The primer sets used for amplification as follow,
β-actin F:TGACAGGATGCAGAAGGAGA, R:TAGAGCCACCAATCCACACA, HSP-90 F:TGTTGGGACCAGCAACTCAA, R: TTTGAGGCTCAGTGGTAGCC, MMP-9 F:GGCAGCTTCAACAACCATCA, R: GGATGGACTAGATCGGAGCC, 6UB F: AACGCTTCACGATTTGCGT, R: CTCGCTTCGGCAGCACA ,
and miR- 21 F:TAGCTTATCAGACTGATGTTGA, R: GAATCGAGCACCAGTTACGC.
The RQ of each target gene is quantified according to the calculation of delta-delta Ct (ΔΔCt). We calculated the RQ of each gene by taking 2-∆∆Ct .
2.8. Statistical analysis:
All data analyses were performed using SPSS version 9.0 (SPSS, Inc., Chicago IL).
3. Results
3.1. Clinical evaluation:
Immersing of the animal's back in boiling water at 100°C for 10 sec causing slight cutaneous redness and blistering for 2 hr after exposure, which become pale with time and the ruptured blisters was developed at 6, 12 & 24hr in both treated and non-treated animals, but the number of ruptured blisters was reduced in the treated animals. A thin crust or thick crust in some animals was observed after 7 days from the immersing which sloughed and the underlying granulation tissue was appeared at 14 day. The most obvious observations that noticed in the treated animals with BM-MSCs, are the developing of bluish coloration at 12 hr post immersing and the thick stiff crust which detected at 7 days still continued until the end of the experiment (at 14 day) (Fig. 1).
Concerning the percentage of the wound contraction rate in scald animals (G2), it’s markedly decreased at 14 day, while in comparison with the treated animals (G5) the rate was increased significantly at 12 hr (Fig. 2).
3.2.Histopathological findings:
Skin sections of scalded male albino rats (G2) were showed severe necrosis of the epidermal and dermal layers additionally, severe degenerative changes and necrosis of hair follicles, sweat, and sebaceous glands with the presence of coagulative acidophilic fused collagen fibers (Fig. 3 A, B &C), and (Fig. 4 A, B, C & D).
Skin sections of the treated animals with BM-MSCs (G5) were showed the similar pathological lesions in both epidermal and dermal layers including sweat gland, sebecous glands and hair follicles without any improvement (Figs. 3 a, b &c) and (Fig.4 a, b, c &d).
3.3.mRNA expression rate of TGF-β and the pro-inflammatory cytokines (IL-6 & TNF-α):
The TGF-β mRNA expression rate in all-time intervals of scald healing was significantly down regulated in comparison to the control group (G1), In group (3) in which the scald animals treated with BM-MSCs, animals showed noteworthy down regulation in the expression rate at zero time, 2, 6 & 24 hrand the significant up-regulation was detected at 12 hr, 7 & 14 day(Fig. 4). Figure (5) was illustrated that the expression rate of IL-6 was remarkably up-regulated at at all-time intervals in comparison to the control group (G1).In contrast, S/C injection of BM-MSCs in the scalded animals (G3) causing significant down regulation in IL-6mRNA expression rate at all-time intervals.
In comparison to the control group (G1) the expression rate of TNF-α in the scalded animals was salient down regulated at acute intervals of wound healing (zero time, 2, 6, 12 & 24 hr),after treatment with BM-MSCs (G5), the expression rate was significantly down regulated in all-time intervals (Fig. 6).
3.5.mRNA expression rate of HSP-90α, MMP-9 and miR-21 genes:
Significant down regulation of HSP-90α expression rate was detected in the animals subjected to scald (G2) in comparison to the control group (G1). On the other hand, treating of the immersed animals with BM-MSCs (G3) leading to significant up regulation of HSP-90α expression rate in 6&24 hr and 7 &14 day (Fig. 7). While the expression rate of MMP-9 was markedly up-regulated at all-time intervals in comparison to the control group (G1).
In contrast, the rate was significantly reduced at 6&24hr, and 7&14 day after the S/C injection of BM-MSCs (G3)(Fig. 8). Figure (9) was revealed significant up-regulation of miR-21 expression rate in all-time intervals of the scald wound (G2) in comparison to the control group (G1). Whilst, the expression ratewas significantly down regulated at 6& 24 hr, and 7 & 14 day.
4. Discussion
Hemostasis, inflammation, proliferation, and remodeling are well-orchestrated supportive dynamic processes which responsible for repairing the cutaneous injury (Reinke and Sorg, 2012). MSCs have a significant role in all phases of wound repair by varying grades. They could stimulate the wound to proceed towards the inflammatory stage not to fall back to the chronic wound state (Aggarwal and Pittenger, 2005), in the current studythe inflammatory cells still reported till 14 day which agreed with Caliari-Oliveira et al. (2016). The immunomodulation property of MSCs enable them to attenuate the inflammatory response directly through inhibition the pro-inflammatory cytokines production as TNF-α and IFN γ with simultaneous elevation of the anti-inflammatory cytokines secretion such as IL-10 and IL-4 (Aggarwal and Pittenger, 2005), besides their inhibitory effect on neutrophil infiltration and IL-6 (Abbas et al., 2018), and the successful wound healing is achieved through resolution of inflammation (Xuet al., 2012) which recorded in the current study in which the expression rate of IL-6 and TNF-α were significantly down regulated,while the expression rate of TGF-β was significantly up-regulated 14 day that come in accordance with Gilbert et al. (2016).The wound closure has been accelerated in response to MSCs or MSC-conditioned medium, because of their ability to stimulate the dermal fibroblasts which produce huge amount of collagen type I and alter the gene expression (Smith et al., 2010).
Li et al. (2012) reported that growth factors not the only factors responsible for wound closure. But also, Hsp90α has a significant role in this process via promoting the cellular survival and motility (Dong et al., 2016). Moreover, it was responsible for the migration of human epidermal and dermal fibroblasts (Cheng et al., 2008).
The expression rate and the activity of gelatinase MMPs (MMP9 and MMP2) were significantly up-regulated through TGF-β, in which it’s expression rate markedly down-regulated with inhibition of miR-21 (Liu et al., 2016), other results reported that the miR-21 was in-dispensable for TGF-β-driven keratinocyte migration in vitro and
could enhance the process of re-epithelialization during wound healing in mice (Yang et al., 2011).
The Paracrine function of BM-MSCs causing up-regulation of TGF-β3 and MMP-9, leading to increasing the formation of granulation tissue with inhibition ECM deposition during the proliferative phase (Gilbert et al., 2016). MSCs have the ability to inhibit the regression of collagenous matrix and maintaining the matrix with promotion the regeneration of fibroblast through down regulation the expression rate of (MMP)-1 (Jeonet al., 2010), hence, they providing favorable conditions for ECM remodeling during the healing process (Lee et al., 2012).
Recent study by (Jiang et al., 2020) revealed that the activation of TGF-β receptors on MSCs may be up-regulated or suppressed the expression level of miR-21, according to the concentration of TGF-b1 in the wound bed, while over activation of TGFβ receptors on MSCs at high TGF-β1 concentrations down-regulates miR-21, so no inhibition of Smad7 translation occurred via miR-21 and ultimately production of TGF-b1 from MSCs was suppressed. Thus the signaling between TGF-β receptor, miR-21, Smad7 and TGF-β1 regulates the release of MSC-derived TGF-b1 production according to the wound site demands (Jiang and Scharffetter-Kochanek, 2020). In the current study the expression rate of MMP-9 and miR-21 was down regulated significantly at 6&12hr and 7&14 day in the treated animals BM-MSCs.
5. Conclusion
Therapy of full thickness scald wound with BM-MSCs leading to significant down regulation of the expression rate of the pro-inflammatory cytokines (IL-6 and TNF-α), miR-21,and MMP-9, marked up-regulation of TGF-β, and HSP-90α specially at late phases of wound healing, while no improvements were recorded at the level of clinical evaluation and histopathological examination.
Conflict of interest
The authors declare no potential conflict of interest.
References
[1] Knight, B. (1996): Burns and scalds. In: Knight B, ed. Forensic Pathology. 2nd ed. London, UK: Arnold., 305-317.
[2] Wohlsein, P.; Peters, M.; Schulze, C.andBaumga¨rtner, W. (2016): Thermal Injuries in Veterinary Forensic Pathology. Veterinary Pathology, 53(5):1001-1017.
[3] Sánchez, J. L.; Perepérez, S. B.; Bastida, J. L. and Martínez, M. M. (2007): Cost-utility analysis applied to the treatment of scald patients in a specialized center. Arch Surg., 142(1):50-57.
[4] Marshall, S. W.; Runyan, C. W.; Bangdiwala, S. I.; Linzer, M. A.; Sacks, J. J. and Butts, J. D. (1998): Fatal residential fires: who dies and who survives? JAMA 279:1633-1637.
[5] Alden, N. E.; Bessey, P. Q.; Rabbitts, A.; Hyden, P. J.; Yurt, R. W. (2007): Tap water scalds among seniors and the elderly: socio-economics and implications for prevention. Scalds, 33(5):666-669.
[6] Kanji, S. and Das, H. (2017): “Advances of Stem Cell Therapeutics in Cutaneous Wound Healing and Regeneration,” Mediators of Inflammation, vol. 2017, Article ID 5217967, 14 pages, 2017.
[7] Leclerc, T.; Thepenier, P.J.; Bey, E.; Peltzer, J.; Trouillas, M.; Duhamel, P.; Bargues, L.; Prat, M.;
Bonderriter, M. and Lataillade, J.J. (2011): Cell therapy of burns. Cell Prolif.. 44, 48-54.
[8] Pati, S.; Pilia, M.; Grimsley, J. M.; Karanikas, A. T.; Oyeniyi, B.; Holcomb, J. B. and Rasmussen, T. E.
(2015): Cellular Therapies in Trauma and Critical Care Medicine: Forging New Frontiers. Shock (Augusta, Ga.), 44(6), 505-523.
[9] Butler, K.L.; Goverman, J.; Ma, H.; Fischman, A.; Yu, Y.M.; Bilodeau, M.; Rad, A.M.; Bonab, A.A.;
Tompkins, R.G.; Fagan, S.P. (2010): Stem cells and burns: Review and therapeutic implications. J. Burn
Care Res., 31, 874-881.
[10] Shumakov, V. I.; Onishchenko, N. A.; Rasulov, M. F.; Krasheninnikov, M. E. and Zaidenov V. A. (2003):
Mesenchymal Bone Marrow Stem Cells More Effectively Stimulate Regeneration of Deep Burn Wounds than Embryonic Fibroblasts. Bulletin of Experimental Biology and Medicine, 136(8): 220-223.
[11] Lewis, C. J. (2013): Stem cell application in acute burn care and reconstruction. J Wound Care 22(1): 7-8, 10, 12-6.
[12] Dash, N.R.; Dash, S.N.; Routray, P.; Mohapatra, S. and Mohapatra, P.C. (2009): Targeting nonhealing ulcers of lower extremity in human through autologous bone marrow derived mesenchymal stem cells.
Rejuvenation Res 12(5):359-366.
[13] Merck, M. D. and Miller D. M. (2013): Burn-, electrical-, and fire-related injuries. In: Merck MD, ed.
Veterinary Forensics: Animal Cruelty Investigations. 2nd ed. Ames, IA: Wiley-Blackwell., 139-150.
[14] Munro, R. and Munro, H. (2008): Thermal injuries. In: Munro R, Munro H, eds. Animal Abuse and Unlawful Killing: Forensic Veterinary Pathology. Edinburgh, UK: Elsevier., 48-54.
[15] Sun, X.; Jiang, H. and Yang, H. (2007): In vitro culture of bone marrowmesenchymal stem cells in rats and differentiation into retinal neural-like cells. Journal of Huazhong University of Science and Technology- Medical Sciences, 27: 598-600.
[16] Chaudhary, J. K. and Rath, P. C. (2017): A simple method for isolation, propagation, characterization, and differentiation of adult mouse bone marrow-derived multipotentmesenchymal stem cells. Journal of Cell Science and Therapy, 8: 1-10.
[17] Yang, Q.; Mehmet, A.; Orman, M. A.; Francois Berthiaume, F.; Ierapetritou, M. G. and Androulakis I. P.
(2012): Dynamics of Short-Term Gene Expression Profiling in Liver Following Thermal Injury J Surg Res., 176(2): 549-558.
[18] Revilla, G.; Afriani, N. and Rusnita, D (2018): Effects of Bone Marrow Mesenchymal Stem Cell to Transforming Grow Factor-β3 and Matrix Metalloproteinase-9 Expression in Burns, J. Med. Sci., 18 (4):
164-171.
[19] Galiano, R. D.; Michaels J.; Dobryansky, V. M.; Levine, J. P. and Gurtner, G. C. (2004): Quantitative and reproducible murine model of excisional wound healing. Wound Repair and Regeneration, 12(4): 485-492.
[20] Bancroft, J. D.; Gamble, M. (2002): Theory and practice of histological techniques.5th. Ed. Edinburgh.
Churchill Living stone Pub.
[21] SPSS Inc. (1998): SPSS Base 8.0 for Windows User's Guide. SPSS Inc., Chicago IL.
[22] Reinke JM, Sorg H. Wound repair and regeneration. EurSurg Res. 2012; 49: 35-43.
[23] Aggarwal, S. and Pittenger, M. F. (2005): Human mesenchymal stem cells modulate allogeneic immune cell responses. Blood, 105:1815-22.
[24] Caliari-Oliveira, C.; Yaochite, J. N.; Ramalho, L. N.; Palma, P. V.; Carlos, D.; Cunha, F.; De Souza, D.
A.; Frade, M. A.; Covas, D. T.; Malmegrim, K. C.; Oliveira, M. C. and Voltarelli, J. C. (2016):
Xenogeneic Mesenchymal Stromal Cells Improve Wound Healing and Modulate the Immune Response in an Extensive Burn Model. Cell transplantation, 25(2): 201-215.
[25] Abbas, O. L.; Özatik, O.; Gönen, Z. B.; Öğüt, S.; Entok, E. and Özatik, F. Y. (2018): Prevention of burn wound progression by mesenchymal stem cell transplantation. AnnPlast Surg., 81(6):715-24.
[26] Xu, J.; Wu, W.; Zhang, L.; Dorset-Martin, W.; Morris, M. W. and Mitchell, M. E. (2012): Therole of microRNA-146a in the pathogenesis of the diabetic wound-healing impairment: correction with mesenchymal stem cell treatment. Diabet., 61:2906-12.
[27] Gilbert, R.W.; Vickaryous, M. K. and Viloria-Petit, A. M. (2016): Signalling by Transforming Growth Factor Beta Isoforms in Wound Healing and Tissue Regeneration. J Dev Biol., 4: 21.
[28] Smith, A. N.; Willis, E. and Chan, V. T. (2010): Mesenchymalstem cells induce dermal fibroblast
responses to injury. Exp Cell Res., 316:48-54.
[29] Li, W.; Sahu, D. and Tsen, F. (2012): Secreted heat shock protein-90 (Hsp90) in wound healing and cancer. BiochimBiophysActa., 1823:730-41.
[30] Dong, H.; Zou, M.; Bhatia, A.; Jayaprakash, P.; Hofman, F. and Ying, Q. (2016): Breast cancer MDA- MB-231 cells use secreted heat shock protein-90alpha(Hsp90a) to survive a hostile hypoxic environment. Sci Rep., 6:20605.
[31] Cheng, C. F.; Fan, J.; Fedesco, M.; Guan, S. and Li, Y. (2008): Transforming growth factor alpha (TGFalpha)-stimulated secretion of HSP90alpha: using the receptor LRP-1/CD91 to promote human skin cell migration against a TGFbeta-richenvironment during wound healing. Mol Cell Biol., 28: 3344-3358.
[32] Liu, Y.; Li, Y. and Li, N. (2016): TGF-β1 promotes scar fibroblasts proliferation and transdifferentiationvia up-regulating MicroRNA-21. Sci Rep., 6: 32231.
[33] Yang, X.; Wang, J.; Guo, S. L.; Fan, K. J.; Li, J.; Wang, Y. L.; Teng, Y. and Yang, X. (2011): miR -21 promotes keratinocyte migration and re-epithelialization during wound healing. Int J Biol Sci., 7(5):685- 90.
[34] Jeon, Y. K.; Jang, Y. H.; Yoo, D. R.; Kim, S. N.; Lee, S. K. and Nam, M. J. (2010): Mesenchymal stem cells’ interaction with skin: wound-healing effect on fibroblast cells and skin tissue. Wound Rep Regen., 18:655-61.
[35] Lee, S. H.; Jin, S. Y.; Song, J. S.; Seo, K. K. and Cho, K.H. (2012): Paracrine effects of adiposederivedstem cells on keratinocytes and dermal fibroblasts. Ann Dermatol., 24:136 -43.
[36] Jiang, D.; Singh, K.; Muschhammer, J.; Schatz, S.; Sindrilaru, A. and Makrantonaki, E. (2020): MSCs rescue impaired wound healing in a murine LAD1 modelby adaptive responses to low TGF -beta1 levels.
EMBO Rep. 21:49115.
[37] Jiang, D. and Scharffetter-Kochanek, K. (2020): Mesenchymal Stem Cells Adaptively Respond to Environmental Cues Thereby Improving Granulation Tissue Formation and Wound Healing. Front. Cell Dev Biol., 8: 697.
24 hr
Scald
Zero time 2hr 6 hr 12hr 7 days 14 day
Fig. (1): Macroscopic appearance of scald wound and the treated wound with BM-MSCs.
Fig. (2): Percentage of the contracture rate of scald wound and the treated wound with BM-MSCs.
40 60 80 100 120 140 160
Zero time 2 hr 6 hr 12 hr 24 hr 7 days 14 day
Percentage of wound contrantion rate
Scald Scald &BM-MSCs
Contracture rate (%)
Time intervals b
b b
b
b b
a c
b Scald&
BM- MSCs
Figure (3): Histopathological alterations of the scald wound including zero time, 2 &6 hr in A, B & C respectively, and the treated wound with BM-MSCs for the same corresponding hours in a, b&c respectively.
Figure (4): Histopathological alterations of the scald wound including 12&24hrand 7 &14 day in A, B, C&D respectively, and the treated wound with BM-MSCs for the same corresponding hours in a, b,c&drespectively.
Fig. (4):mRNA expression rate of TGF-β in scald wound and the treated wound with BM-MSCs.
0 20 40 60 80 100 120
Control Zero time 2 hr 6 hr 12 hr 24 hr 7 days 14 day TGF-β
Control Scald Scald&BM-MSCs
Gene expression rate of TGF-β compared to β-actin
Time intervals i
d.e
c c.d
e.f
g
e.f f.g
a
b b
h
c.d
g
h.i C: Desinometric analysis of PCR products of TGF-β
A: Gel photographshowing PCR products of TGF-β in scald
TGF-β
β- actin
B: Gel photograph showing PCR products of TGF-β in scald& BM-MSCs
TGF-β
β- actin
Control Zero time 2 hr 6 hr 12 hr 24 hr 7 days 14 day
Zero time 2 hr 6 hr 12 hr 24 hr 7 days 14 day
Fig. (5):mRNA expression rate of IL-6 pro-inflammatory cytokine in scald wound and the treated wound with BM- MSCs.
0 20 40 60 80 100 120 140 160
Control Zero time
2 hr 6 hr 12 hr 24 hr 7 days 14 day
IL-6
Control Scald Scald& BM-MSCs
Gene ex pression rate of IL -6 com pared to β- actin
Time intervals
a
i i
h i
g
i f g
c e d
c b c
Control Zero time 2 hr 6 hr 12 hr 24 hr 7days 14 day
A: Gel photograph showing PCR products of IL-6 in scald
IL-6
β- actin
Zero time 2 hr 6 hr 12 hr 24 hr 7 days 14 day
B: Gel photograph showing PCR products of IL-6 in scald& BM-MSCs
IL-6
β- actin
C: Desinometric analysis of PCR products of IL-6
Fig. (6):mRNA expression rate of TNF-α pro-inflammatory cytokine in scald wound and the treated wound with BM-MS
0 20 40 60 80 100 120 140
Control Zero time
2 hr 6 hr 12 hr 24 hr 7 days 14 day
TNF-α
Control Scald Scald&BM-MSCs
Gene ex pression rate of TNF α com pared to β- actin
Time intervals f
c
d d
e e e.f e.f
a a a
b
a a.b
a C: Desinometric analysis of PCR products of TNF-α
Control Zero time 2 hr 6 hr 12 hr 24 hr 7 days 14 day
A: Gel photograph showing PCR products of TNF-α in scald
TNFα
β- actin TNF-α
Zero time 2 hr 6 hr 12 hr 24 hr 7 days 14 day
B: Gel photograph showing PCR products of TNF-α in scald& BM-MSCs
TNF-α
β- actin
Fig. (7): mRNA expression rate of HSP-90α gene in scald wound and the treated wound with BM-MSCs.
0 0.5 1 1.5 2 2.5 3 3.5
Control Zero time 6 hr 24 hr 7 days 14 day
HSP-90α
Control Scald Scald&BM-MSCs
Gene ex pression rate of HSP -90 α com pared to β- actin
Time intervals
g
a b
c
e
f
a
c d
f
g Amplification blot curves for RT-qPCR of HSP-90αgene vs. β-actin in scald wound and the treated wound with
BM-MSCs.
Fig. (8):mRNA expression rate of MMP-9 in scald wound and the treated wound with BM-MSCs.
0 1 2 3 4 5 6
Control Zero time 6 hr 24 hr 7 days 14 day
MMP-9
Control Scald Scald&BM-MSCs
Gene ex pression rate of MMP -9 com pared to β- actin
Time intervals
a
g g
f
e
d g
f
e
c
b Amplification blot curves for RT-qPCR of MMP-9 gene vs. β-actin in scald wound and the treated
wound with BM-MSCs.
Fig. (9):mRNA expression rate of miR-21 gene in scald wound and the treated wound with BM-MSCs.
0 1 2 3 4 5 6 7
Control Zero time 6 hr 24 hr 7 days 14 day
miR-21
Control Scald Scald&BM-MSCs
Gene ex pression rate of m iR -21 com pared to 6UB
Time intervals
a
i h
g
e
d i
f
e
c
b Amplification blot curves for RT-qPCR of miR-21gene vs. 6 UB in scald wound and the treated wound with
BM-MSCs.
