Molecular Detection of Mepa Gene from Staphylococcus Aureus Isolated from Cases of Tonsilitis
Assist. Prof. Dr. Mustafa Salah Hasan1, Wasan A. Majeed2, Lubna Dhari Mohammed3
1 College of Vet. Med., University of Fallujah [email protected]
2Department of Biology, College of Education for Pure Science, University of Diyala
3Gilgamesh Ahliya University
Abstract Introduction:
Bacterialtonsillitisdefined asinfection for tract of upperrespiratory thisinfection infects
adolescents and children.S.aureus isthepathogenoccur intonsillitis etiologythat duetoresistance to antimicrobial in the tonsil'stissues.Tonsillectomy that presentsin tonsillitis cases after treatment failures by therapy in antibiotic.
Design of the study:
To complete this research, procure 17 surgically removed tonsils from individuals who had a previous history of tonsillitis When we tested the tonsils for Staphylococcus aureus, we sent them to a lab for microbiological testing to look for the particular microorganism. All isolates were tested by PCR for the presence or absence of mepA gene.
Results:
From 17 patients who were 12 years old on the average, 15 Isolates were obtained. mepA gene was present in all isolates. Most isolates were resisting to many antibiotics.
Conclusions:
The isolates of S. aureus were resist to most antibiotics and all havemepA gene . Introduction
Infection in the palatine tonsils called tonsillitisthatinfectchildren,as well asyoungadults.1Many studiesexplainedrecurrenttonsillitis etiology,thatremainsacontroversialtopic.But acute tonsillitis cause by single microbial species, it suggested polymicrobial infection is which cause recurrenttonsillitis.2Also, chronic tonsillitis cause by other microorganisms.1Bacterial biofilm thatdefined thatimportant factorinvolved in resistance for antibiotic treatment and infections chronicity.For this reason, these infectionsgive negative impact on significant burden on public health patients ‘alsolife quality.Bacterialbiofilmsthathaveimportantroleinrecurrentin
respiratorytractinfections, thatinclude chronic disease for tonsillar, also thatfoundinthechildren tissueinfected with chronic infections in tonsills.3S. aureusproduce by betalactamasepromoting resistance for penicillin intonsilsmicrobiota.
Many studiesshow antibiotic therapyfailure becauseunderestimationfor resistant microorganisms,1that explain bylow concentrations for antibiotic in tonsillartissue,combinedwithbacteriapresence which producingresistance patterns for antibiotic or protectiveenzyme, where persistence in this site that because bacterium presencein tonsil tissue.Tonsillar surface presents bacteria belongingto internal tissue contains pathogenic microorganisms also, the normaloral microbiota.Staphylococcusaureuspresence inboth internal and external tissues for tonsils.4
In thisstudy, the aim was to detectStaphylococcusaureusfrom tonsils that remove due to its recurrent alsoantimicrobialsusceptibility forisolates and molecular identification of mepA gene.
Sampling
Studysubjects foroneyear,17 samples from outpatient withage average of 12-year-old wascarried to the Surgical Clinic to achievethe tonsillectomy.The patient had tonsillar hyperplasia history after failures in respond to therapy of antimicrobial.Where,the tonsil was put in sterile container.
Samples Processing
The tonsils samples were homogenized in a sterile Water and then inoculated in Mannitol Saltagar as well as blood agarforisolation of bacteria.Identified of the isolates were according to methods of standard.4
Detection of mepA gene by PCR
mepAgenewas detected by using the following primers:
F:5′- ATGTTGCTGCTGCTCTGTTC-3′ (718 bp) R:5′- TCAACTGTCAAACGATCACG 3′
Results
Tonsils were taken from 17 patients, aged 0.9–49 year, was analyzefor oneyear.Age mean of patients were12.4year,ofwhom 54.8% were female and 45.4%male.15 tonsils isolatethat identified asStaphylococcus aureus by detection of mepA gene (Fig.1).
Figure 1. Gel electrophoresis for PCR amplification product of mepA gene (1.5% agarose, 70 voltage for 90 min), Lane L: 1500 bp DNA ladder. Lane 1-15 represent the positive results of S.aureus isolates (718bp)
The patients at the tonsillectomy time, had no process of acuteinflammatory.Staphylococcus aureus was isolated in 8 from 17 (47%) patients age0.9–37 year (mean aged = 12.8 year),in whom 77.1% had presentedhypertrophy of tonsillar, with obstruction degrees varyingbetween third and fifth degree.
In 13.0% of the patient, Staphylococcus aureusis the only agents found, and in 17.1%
threefromStaphylococcus aureus with different genotypic were identified, 79.0% from17 patients, reported that before tonsillectomy was using antimicrobial.
The choice drug for treatment pharyngotonsillitisis penicillin,wherethat used by 45.1% of the patients. Staphylococcus aureus give resistance to amoxicillin (84.7%),ciprofloxacin (27.1%), cefoxitin (25.7%) andalso amoxicillin--clavulanate (12.9%).
MostisolatesweresusceptibletoPenicillin andCiprofloxacin as show in (Table1).
Table 1.S. aureussusceptibility to different antibiotics
Anti-microbial Resistance %
Penicillin 45.1
Ciprofloxacin 27.1
Cefoxitin 25.7
Erythromycin 16.4
Tetracyclin 13.1
Amoxicillin-clavulanate 12.9
Clindamycin 9.8
Ceftriaxone 4.9
Rifampin 1.6
Linezolid 1.6
Discussion
Bacterialpharyngotonsillitisthatmicrobial infection effectson children also adolescent from (5-15) years.6
The mean age in this study of the patient involved was 12.3years.Contacts of children inday care centers, home, and school,show that iscauseincreaseinoralmicrobiota,leadingtoincrease in infection recurrence.5There were no notable differences in sex among people who underwent various forms of routine tonsillectomy in numerous studies were 76.6% of the patients had pharyngitis.Studyshow that main indications for tonsillectomy arenocturnal snoring, recurrent pharyngotonsillitis, respiratory pause, tonsillar hypertrophy and with sleep apnea.6
ThehighprevalenceforStaphylococcus aureus in this study was(42.7%)showafter inflammatory process there are bacterial persistence in the tonsils.Staphylococcus aureus have primary sites are throatand anterior nostril region.The main agent of tonsillitis is identification forStaphylococcus aureus reported by studies, withprevalence 84.1%.7Staphylococcus aureus is presence in tonsilinfections and its even after the inflammatory process that persistence in tonsillar tissue related to its ability in form biofilm, which explain therapeutic failures, therefore,infection recurrence that important in chronicity.
The isolates resistance in Ciprofloxacin and Cefoxitin was 27.1% and25.7% to the association with pencillin.8Thisis studyshow resistanceratewas highwasduetoproduction of lactamaseenzyme.ThetherapeuticfailuresofCiprofloxacinled
tousingotherantimicrobialscephalosporins.Staphylococcus aureusthatemergency forMEPA strainsin the hospital environment and the community.3
In this study, two isolates foundMEPA recurrent isolation intonsillitis in Franca.InJapan,studies shown8.9%of MEPAisolates have pharyngtonsillitissymptoms, andin other studies found that 15.9% of MEPA in patient’s tonsils thatsubmitted fortonsillectomy due to recurringtonsillitis.4 Therefore,norelationship betweenpharyngotonsillitis and MEPA.Ciprofloxacin resistance that best marker to MEPA, screening, (13.0%) from isolates that resistant to Ciprofloxacin identified as MEPA by detection of mecA gene.Methicillin resistance due tomutation ingenesencodinglactamases overproduction or by normalPBP.5These mutations generate modifications in structural, which alter proteins bindingwithlactams antibiotics by determining antimicrobial resistance anddecreasing theiraffinity.PBPs overexpression occur by mutations that lead to small resistance but give significant increase in antibiotics for lactam.25Also,Staphylococcusaureus resistance to Cefoxitin. 6Staphylococcus aureus producing of lactamasesgive resistant for penicillin enzyme.Isolateshavenotidentifiedfor mecA gene by conventional PCRs.Theresistanceratewas25.7%to Ciprofloxacinisworrisome.This drug is effective againstagent’scause tonsillitis, includingStaphylococcusaureus.
Resistance to MLSbdetectedin8.7%oftheisolates, thatmediated by the gene presence, which causes therapeutic failures and relapses. For staphylococcal infections use clindamycin that therapeutictoleratedbychildren,andthepatientsinfected in allergictopenicillin. 8MDR strains that
isolatesidentified, in this study the patients involved treated as outpatients.Because of the direct interaction between children and youth, this strain has a very high level of transmissibility.This is virulence factor forstaphylococcal aureus that cause pneumonia.Staphylococcus aureus iscarrying lysogenicphage which contain PVL genes.The isolates analysis that demonstratedgenetic diversity between them.1
It has been discovered that any re-creation of the colonization dynamic and the persistent genetic mutation may have existed in the tonsil. These can be seen in any animal, not only S. aureus denies the progression from sore throat to gingivitis. By using an antimicrobial often reduces the recurrence of pharyngitis, these two treatments aid in both detection and recovery.2
References
1- Riley, M. et al. (2006) Nucleic Acids Res 34: 1-6 (corrected supplemental data from B.
Wanner)
2- Keck, W et al. (1990) Cloning and characterization of mepA, the structural gene of the pencillin-insensitive murein endopeptidase from Escherichia coli. Mol. Microbial. 4 209- 19
3- Baba, T et al. (2006) Construction of Escherichia coliK-12 inframe, single-gene knockout mutants: The Keio collection. Mol. Syst. Biol.2 2006.0008
4- CGSC: The Coli Genetics Stock Center
5- Ito, M et al. (2005) Functional analysis of 1440 Escherichia coli genes using the combination of knock-out library and phenotype microarrays. Metab. Eng. 7 318-27 6- Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library
(a complete set of Escherichia coli K-12 ORF archive): unique resources for biological research. DNARes. 12 291-9
7- Kohara, Y et al. (1987) The physical map of the whole Escherichia coli chromosome:
application of a new strategy for rapid analysis and sorting of a large genomic library.
Cell 50 495-508
8- The Tn10 insertion sites determinate by Nichols et al. 1998 were reannotated by alignment with Escherichia coli K-12 genome sequence (GenBank accession NC- 000913) P1Wu
