Detection of Lasb and Plch Genes in Pseudomonas Aeruginosa Isolated From Urinary Tract Infections by PCR Technique
Kansaa Akram Hasan*1, Prof. Dr. Ali Saleh Hussein2, Prof. Dr. Taghreed Khudhur Mohammed3.
1Assistant Chief Technical Trainer, Middle Technical University, Institute of Medical Technology / Al-Mansour, Iraq, [email protected]
2Al-Iraqia University, Baghdad, Iraq,
3Middle Technical University, Institute of Medical Technology/Al-Mansour, Baghdad, Iraq,
Abstract:
Background: Pseudomonas aeruginosa is a Gram-negative bacterium, and it is a pathogen of opportunistic diseases that affects human with immunodeficiency or breaches of normal bodily defenses.
Aims: Isolation of P. aeruginosa bacteria from administration samples from patients with UTI, diagnosing this bacterium using enriched and selective culture media in addition to the biochemical assays. It also aims to extract bacterial DNA from isolates to investigate the lasB and plcH genes responsible for some virulence factors in P. aeruginosa, using the Polymerase chain reaction (PCR) technique.
Materials and methods: The current study included the collection of 477 samples of patients suffering from Urinary tract infections (UTIs) of both sexes, whose ages ranged between (19- 65) years, for the period from September 1, 2020 to December 31, 2020, from several hospitals in the city of Baghdad.
Results: After the final diagnosis of the samples, 50 (10.48%) isolates of P. aeruginosa were obtained. The percentage of infection with this bacteria was higher in males than in females, 26 (52%) and 24 (48%), respectively. The highest rate of bacterial infection was in the age group (51-60) years, at 38%. The isolates were tested for antibiotic sensitivity using the Kirby-Bauer method, and the highest antibiotic resistance was Ceftazidime (98%), Aztreonam (96%), Amikacin (76%) and Tobramycin (74%). DNA was extracted from all bacterial isolates, and the polymerase chain reaction (PCR) was performed using specialized primers to investigate the lasB and plcH genes. The results showed that 24 (48%) isolates contain the lasB gene, and the resulting bundles were found to have a molecular weight (284 bp). The results also revealed that 24 (48%) isolates contain plcH gene with a molecular weight of the bundles (608 bp).
Conclusion: it was found in the current study that the bacterial isolates that contained the lasB gene are the same as that containing the plcH gene, so the possibility of these isolates for pathogenicity is higher than if they contained only one of the two genes.
Key words: Pseudomonas aeruginosa, lasB gene, plcH gene, Urinary tract infections (UTIs).
Introduction:
Pseudomonas aeruginosa is a Gram-negative bacterium, from the family of Pseudomonadaceae, that is ubiquitous and is able to survive in a wide range of environments (Silby et al., 2011). This bacterium is one of the pathogens of opportunistic diseases that affect people who are immunocompromised or who suffer from breaches of normal bodily defenses. It is a pathogen that can infect all human tissues and organs such as the urinary tract, respiratory system, bones, joints, soft tissues (burns) and dermatitis (Gellatly and Hancock, 2013).
Urinary tract infections UTI is one of the most common infections spread around the world. It is the most common reason for the use of antibiotics in Europe and America (Abbo and Hooton, 2014). Although the incidence of urinary tract infections caused by P.
aeruginosa is lower than that of Escherichia coli and Klebsiella pneumoniae, however, complex urinary tract infections as well as catheter-related and hospital conditions are more frequent in P. aeruginosa than the mentioned species. (Ironmonger et al., 2015).
P. aeruginosa possesses a wide range of virulence factors that facilitate infection and colonization of host cells (Newman et al., 2017; AL-Rubaye et al., 2020; AL-Rubaye et al., 2020). In addition, some virulence factors in P. aeruginosa are responsible for some genes, including the lasB gene that encodes the enzyme lasB elastase. This enzyme has an active role in protein degradation and necrosis processes (Shuwaikh, 2016), it is also a highly toxic agent that causes tissue damage and invasion (Cathcart et al., 2011). P. aeruginosa also possesses the plcH gene that encodes for the phospholipase enzyme, which is an important virulence factor because it helps pathogens invade the host's cell and modify the phospholipid content in the host's cell membrane, and it is also essential in assisting bacteria in the host's immune evasion mechanism (Bandana et al., 2018). Therefore, the aims of this study are to isolate P.
aeruginosa from administration samples from patients with UTI and diagnose this bacterium using rich and selective culture media and biochemical assays. It also aims to extract the bacterial DNA from the isolates of this bacterium, and to investigate the lasB and plcH genes, which responsible for some of the virulence factors in this bacterium, using the Polymerase chain reaction (PCR) technique.
Materials and Methods:
Samples collection: This study included the collection of 477 urine samples from patients with urinary tract infection of both sexes, ranging in age from (19-65) years, for the period from September 1, 2020 to December 31, 2020, from the Teaching Laboratories Hospital, the Specialized Surgery Hospital, and the Hospital Baghdad Education Department of the City of Medicine. In addition to Al-Karamah Teaching Hospital and Al-Yarmouk Teaching Hospital.
Identification of bacterial isolates: The isolates of P. aeruginosa were diagnosed and confirmed by using these methods as follows:
Cultivation of samples: Blood agar, MacConkey agar medium, Cetrimide agar were used to study the phenotype of colonies of P. aeruginosa. King A medium, King B medium, were prepared according to the instructions of company (Himedia, India) and (Mortimer et al.,
1981) to isolate and diagnose the bacteria under study. Gram stain was also used to diagnose P. aeruginosa in samples (Baron et al., 2007).
Biochemical tests: The Catalase test, the oxidase test, and the IMVIC test were used (Collee et al., 1996; Prescott, 2002).
Motility test: Motility medium was used to perform this test (Collee et al., 1996).
Grown at 42 C° test: This test was performed using nutrient agar plates which inoculated with P. aeruginosa, then the plates were incubated at 42 °C for 18-24 hours, the positive result was growth at this temperature (Collee et al., 1996).
API 20E system: API 20E diagnostic kit (BioMerieeux, France) is approved to perform confirmatory diagnosis of bacterial isolates.
Staining of urine deposits: The method for dyeing urinary sediment was conducted according to the two sources (Rodriguez et al., 2011; Harris 1969).
Antimicrobial susceptibility test: Disk diffusion method was used on Muller-Hinton medium after culture with isolates of P. aeruginosa to test for antibiotic sensitivity.
DNA Extraction: The bacterial DNA was isolated from the isolates of P. aeruginosa in culture media according to the method of operation of the extraction kit (ZR Fungal/
Bacterial/ Yeast DNA MiniPrepTM, Catalog No. D6005).
Stock Solution of primer preparation: The initiator solutions were prepared according to the manufacturer's instructions (Integrated DNA Technologies; IDT, Canada), to obtain a final concentration of 100 pmol/ μl as a stock solution.
10 Pmol/μl primer solution preparation: The solution was prepared by adding 10 μl of the storage solution to 90 μl of ionic distilled water (ddH2O), then they were mixed well with a Vortex mixer to homogenize the solution before use, after which the solution was kept at a temperature of -20 °C until use (Table 1).
Table (1): primer sequences used in current study
Product size (base pare) (
-3' )5' Primer sequence genes
284 (1) 5'- GGAATGAACGAAGCGTTCTCCGAC - 3'
lasB F
5'- TTGGCGTCGACGAACACCTCG - 3’
R
608 (2) 5'- GCACGTGGTCATCCTGATGC - 3'
plcH F
5'-TCCGTAGGCGTCGACGTAC - 3’
R
(1): Al-Shimmary, 2020; (2): Faraji et al., 2016.
Determination of extracted bacterial DNA concentration and purity: The concentration and purity of the bacterial DNA extracted from isolates of P. aeruginosa was determined according to the source (Nakayama et al., 2016) using a Nanodrop device.
Polymerase chain reaction (PCR) for genes detection: The reaction mixture was prepared using a Maxime PCR preMix kit (i-Taq) 20 lrxn and according to the manufacturer's instructions (iNtRON) as in Table (2):
Table (2): Optimum conditions for PCR to detect for lasB and plcH genes
No. phase Temperature
(°C) Time No. of cycle 1 Initial DNA
Denaturation 95 5 min. 1
2 DNA
Denaturation 95 45 sec.
3 Annealing 60 45 sec. 35
4 Extension 72 45 sec.
5 Final extension 72 7 min. 1
Detection of amplified DNA bands: The presence of amplified DNA packages was investigated according to the source (Al-Ahmadi and Roodsari, 2016).
Results and discussion:
The current study included the collection of 477 urine samples from both sexes, males and females, who suffer from urinary tract infection. After the final diagnosis of the samples, 50 (10.48%) isolates of P. aeruginosa were isolated. The incidence of infection with P.
aeruginosa was higher in males than in females, 26 (52%) and 24 (48%), respectively. The highest rate of bacterial infection was within the age group 51-60 years, followed by the age group 50-41 years, 19 (38%) and 11 (22%), respectively table (3).
Table (3): Age distribution of P. aeruginosa in patients with urinary tract infections Age groups
(year)
Number of P. aeruginosa isolates
Total (%) Male (%) Female (%)
1-10 )0( 0 )0( 0 )0( 0
11-20 )3.84( 1 )4.16( 1 )4( 2
21-30 )7.69( 2 )8.33( 2 )8( 4
31-40 )11.53( 3 )8.33( 2 )10( 5
41-50 )23.07( 6 )20.83( 5 )22( 11
51-60 )38.46( 10 )37.5( 9 )38( 19
61-70 )15.38( 4 )20.83( 5 )18( 9
Total (%) )100( 26 )100( 24 )100( 50
The results of the current study are close to the results of researchers Al-Salamy and Al- Hilli, 2012, where they found that the isolation rate of P. aeruginosa from urine samples in Baghdad was 26 (14.99%) (Al-Salamy and Al- Hilli, 2012). The percentage of isolate bacteria in the current study was 10.48%. In other local studies, the percentages varied from one study to another. Al-Hashemi in 2020 (Al-Hashemi, 2020) indicated that the percentage of isolation of P. aeruginosa from urine samples was 27.27%. Nader and others in 2017 (Nader and others, 2017) were find that 4 of the 11 urine samples were containing P. aeruginosa, at a rate of 36.36%, which is higher than the results of the current study. The reason for this difference
is that local studies focused on investigating P. aeruginosa from isolates taken from a variety of sources (urine, wounds, burns, etc.). While the current study focused on isolating P.
aeruginosa from urine samples only. For the purpose of comparison, only the percentage of presence of P. aeruginosa in urine samples was calculated from other researches, and it was noticed that the number of urine samples was small in these studies and that gives a result which statistically inaccurate regarding the local presence of bacteria.
In the current study, urine samples were cultured on selective and special culture media to isolate P. aeruginosa after performing the general urine examination - GUE of the urine samples. Urine samples were selected for culture and showed a positive result for the leukocyte esterase (LE) test when using Rapid urine dipsticks. Results from this study showed that urine samples with LE test positive and pus cells higher than 5 cells / microscopic field gave positive results on diuretic transplantation. This is consistent with numerous international studies (Simerville et al., 2005; Laosu-angkoon, 2013; Dadzie et al., 2019).
The diagnosis was based on the form of colonies formed by isolates of developing bacteria on the enriched, special and selective culture media mentioned in the materials and methods of work. Where colonies of P. aeruginosa bacteria appeared on selective media (MacConkey agar) in pale yellow color, because they are not fermented by the non-lactose fermenter, figure (1). These results are consistent with the results of previous research (Forbes et al., 2002).
Figure (1): Colonies of P. aeruginosa isolates on the selective culture medium MacConkey agar appear pale yellow.
On the enriched media (blood agar), the bacteria gave-hemolysis colonies, which is evidence of the ability of bacteria to produce hemolysin, which analyzes red blood cells on the culture medium. Whereas the growth of the bacterial colonies' characteristics on the nutrient agar media was distinguished according to their production of dyes and the smell similar to the smell of grapes (Selim et al., 2015). It was also found that the bacteria grew on the nutrient media when incubated at a temperature of 42 ° C for a period of 24 hours. More densely than it is with a degree of 4 ° C, figure (2), and this trait is a diagnostic feature that distinguishes P. aeruginosa from the rest of the species of the genus Pseudomonas (MacFaddin, 2000).
Figure (2): A and B, the density of the growth of colonies of P. aeruginosa isolates on nutrient agar at 42 ° C more than at 4 ° C.
When it comes to the growth of bacteria on cetrimide agar medium, the bacterial colonies appeared greenish-yellow, and these results are consistent with other studies (Tang and Stratton, 2006; Al-Dahmoshi, 2013). As well, the bacterial colonies on King A agar media produced the blue and green pyocyanin medium, while on King B agar medium, all isolates did not produce the biocyanin stain (Blondel-Hill et al., 2007).
Using a regular light microscope, microscopy reveals that P. aeruginosa is a Gram- negative bacillus, and these results are consistent with other studies (Al-Dahmoshi, 2013;
Diggle and Whiteley, 2020). Biochemical tests showed that all bacterial isolates gave a positive result for the catalase test, and bacterial isolates showed a positive result for the oxidase test, and these results were consistent with the results of previous studies (Tadess and Alem, 2006; Al-Daraghi and Al-Badrwi, 2020).
As for the IMViC test, which included the Indole test, the Methyl red test, and the Vogas- proskauer test, results were negative for these three tests. While the results of the citrate utilization test were positive, and the motility test also showed a positive test result, as proven by previous researchers in this field (Rundell et al., 2020). The Urease test also showed a variable result between positive and negative. These results are consistent with many previous studies (Tades and Alem, 2006; Todar, 2011). As for the diagnosis of the Api 20E system, which includes 20 tests, the results were interpreted based on the "Api 20E Analytic Profile Index" and the results showed that 50 isolates belong to P. aeruginosa.
The sensitivity of bacteria to antibiotics was tested for ten antibiotics, and the results of the current study showed that all P. aeruginosa isolates showed a clear difference in the antibiotic resistance used in this study, see table (4):
Table (4): Number of isolates and percentage of antibiotic resistance of P. aeruginosa:
Group Antibiotics Code P. aeruginosa isolates
R (%) I (%) S (%)
Aminoglycosides Tobramycin TOB 37 (74) 2 (4) 11 (22) Amikacin AK 38 (76) 5 (10) 7 (14)
Carbapenems Imipenem IPM 24 (48) 4 (8) 22 (44)
Meropenem MEM 31 (62) 4 (8) 15 (30) Cephalosporins Ceftazidime CAZ 49 (98) -- 1 (2) Quinolones Levofloxacin LEV 11 (22) 11 (22) 28 (56)
A B
Ciprofloxacin CIP 15 (30) 20 (40) 15 (30) Norfloxacin NOR 24 (48) 11 (22) 15 (30)
Monobactams Aztreonam ATM 48 (96) 2 (4) --
Penicillins Piperacillin PRL 25 (50) 21 (42) 4 (8) R: Resistance, I: Intermediate, S: Sensitive
DNA was extracted from 50 isolates of P. aeruginosa growing on nutrient agar medium, according to the instructions of the provider company ZR Bacterial DNA MiniPrepTM D6005. The purity and concentration of the DNA extracted in each bacterial isolate were measured using Nanodrop spectrophotometer system. The concentration of the bacterial DNA of all the isolates was between (55-298) ng / μL, this concentration is sufficient for use in DNA amplification by PCR technique. DNA purity (measured by the absorbance reading at wavelength 260/280 nm) for all bacterial isolates ranged between (1.56 -2). The results of the current study are close to the results of the researcher Al-Azzawi (Al-Azzawi, 2018), as the concentration of DNA samples in her study ranged between (39.8 - 264.5) ng / μL, and the range of purity ranged between (0.84-1.94). As for the results of the study by researcher Al- Shamaa (Al-Shamaa, 2016), the purity of the DNA of the bacterial isolates ranged between (1.8 – 2), and the DNA concentration in the samples ranged between 60-110 ng / μl. Figure (3).
Figure (3): A and B: Gel electrophoresis of genomic DNA extracted from 50 isolates of P.
aeruginosa, 1% agarose gel with a current of 70 V / cm2 for 30 minutes
In the current study, the lasB and plcH genes possessed by P. aeruginosa were detected using a thermocycler for PCR to amplify the DNA according to the conditions required for the thermal cycling device. PCR was performed for all bacterial isolates using specialized primers to detect these two genes. The results showed that 24 (48%) isolates of these bacteria contain the lasB gene, and when comparing the amplified bundles with the volume band index of the DNA ladder, the resulting DNA bundles were found to have a molecular weight (284 bp) as shown in the figures (4A and B). The results also showed that 24 (48%) isolates of the bacteria under study contain the plcH gene. When comparing the amplified bundles with the size range index of the DNA ladder, it was found that the resulting DNA bundles have a molecular weight (608 bp) as shown in the figures (5 A and B).
Figure (4 A): Electrophoresis of the polymerase chain reaction products for lasB gene, the band size is 284 bp. The product was electrophoresed on 2 % agarose at 70 volt / cm2 for 60 min. M: DNA ladder marker (100-2000bp). The lines 3, 4, 5, 6, 9, 11, 13, 15, 16, 18, 19, 20, 22, 25, 26, 28, and 30 are the P. aeruginosa isolates having lasB gene.
Figure (4 B): Electrophoresis of the polymerase chain reaction products for lasB gene, the band size is 284 bp. The product was electrophoresed on 2 % agarose at 70 volt / cm2 for 60 min. M: DNA ladder marker (100-2000bp). The lines 31, 39, 43, 45, 46, 48, and 50 are the P.
aeruginosa isolates having lasB gene.
Figure (5 A): Electrophoresis of the polymerase chain reaction products for plcH gene, the band size is 608 bp. The product was electrophoresed on 2 % agarose at 70 volt / cm2 for 60 min. M: DNA ladder marker (100-2000bp). The lines 3, 4, 5, 6, 9, 11, 13, 15, 16, 18, 19, 20, 22, 25, 26, 28, and 30 are the P. aeruginosa isolates having plcH gene.
Figure (4 B): Electrophoresis of the polymerase chain reaction products for plcH gene, the band size is 608 bp. The product was electrophoresed on 2 % agarose at 70 volt / cm2 for 60 min. M: DNA ladder marker (100-2000bp). The lines 31, 39, 43, 45, 46, 48, and 50 are the P.
aeruginosa isolates having plcH gene.
In local and international studies, Al-Arnaouti found that the percentage of urine isolates possessing the lasB gene is (62.5%) (Al-Arnaouti, 2015), while the researchers, Raouf and Tawfiq, found that the percentage of urine isolates that possess the plcH gene is 66.7% (Raouf and Tawfiq, 2014). In international studies, a group of researchers found that the percentage of urine isolates that contain P. aeruginosa possessing the lasB and plcH genes is 75% each (Sabharwat et al., 2014). On the other hand, other researchers found in 2017 that the percentage of P. aeruginosa that possesses the genes lasB and plcH was 24% and 18.5%, respectively (Waheed Ullah et al., 2017). However, it is noted that the sample size was 54 Isolation, but the study did not clarify the number of urine isolates that were used.
Conclusion: it was found in the current study that the bacterial isolates that contained the lasB gene are the same as that containing the plcH gene, so the possibility of these isolates for pathogenicity is higher than if they contained only one of the two genes.
References:
1. Abbo, L. M., & Hooton, T. M. (2014). Antimicrobial stewardship and urinary tract infections. Antibiotics, 3(2), 174-192.
2. Al-Arnaouti, Abbas Faleh Mahdi (2015). A study of genotyping and some virulence factors of Pseudomonas aeruginosa, Master Thesis, College of Education for Pure Sciences (Ibn Al-Haytham), University of Baghdad, 123 pages. (in Arabic).
3. Al-Ahmadi G. Jami and Roodsari R. Zahmatkesh, 2016. Fast and specific detection of Pseudomonas Aeruginosa from other pseudomonas species by PCR. Annals of Burns and Fire Disasters, 29(4):264-267.
4. Al-Dahmoshi, H. O. M. (2013). Genotypic and Phenotypic Investigation of Alginate Biofilm Formation among Pseudomonas aeruginosa Isolated from Burn Victims in Babylon, Iraq.ph.D.thesis, Babylon University, Science Faculty-Biology Department, Iraq.
5. Al-Daraghi Wathiq Abbas Hatite and Al-Badrwi Mohammed Sattar Abdulkadhim, 2020.
Molecular Detection for Nosocomial Pseudomonas aeruginosa and its Relationship with multidrug Resistance, Isolated from Hospitals Environment, Medico-legal Update,20(1):
632.
6. Al-Hashemi, Sama Khalaf Abdel-Rahman (2020), investigating the bacterium Pseudomonas aeruginosa that is resistant to antibiotics and studying the effect of antibacterial properties of some concentrations of rosemary oils, a master's thesis, Iraqi University College of Education. (in Arabic).
7. AL-Rubaye, Mustafa R S., Mohammed Taghreed Khudhur, Abdullah Hanaa N. (2020) Isolation and Diagnosis of Multi Drug Resistance Pseudomonas aeruginosa from Wound and Burnpatients in Baghdad City, Indian Journal of Forensic Medicine & Toxicology;
14(3): 2431-2437. DOI: https://doi.org/10.37506/ijfmt.v14i3.10801.
8. AL-Rubaye, Mustafa Riyadh Salman, Evren Yildiztugay, Ahmed Uysa,Taghreed Khudhur Mohammed, Hanna N. Abdullah (2020). Molecular detection of virulent exoU mutation of Pseudomonas aeruginosa isolated from wound and burn samples, Eurasia J Biosci; 14: 2811-2816.
9. Al-Salamy, Adnan Kreem and Emad Sadiq Ali Al-Hilli, (2012). Antibiotics Susceptibility pattern of Pseudomonas aeruginosa that isolated from ear, wound and urine samples.
Journal of the College of Basic Education, no. 76: 101
10. Al Shammaa, Noor Fouad Kadhim (2016). Virulence genes profile of Pseudomonas aeruginosa local isolates from burns and wounds, Master thesis, College of Science, University of Baghdad.
11. Al-Shimmary, Sana Mh. 2020. Molecular Identification and Prevalence of Some Virulence Genes among Pseudomonas aeruginosa Isolated from Iraqi Patients, International Journal of Pharmaceutical Research, Supplementary Issue 1: 1542. DOI:
10.31838/ijpr/2020.SP1.237
12. Bandana, K., Jashandeep, K., & Jagdeep, K. (2018). Phospholipases in bacterial virulence and pathogenesis. Adv Biotechnol Microbiol, 10(5), 1-8.
13. Baron, E. J. ; Finegold, S. M. and Peterson, I. L. R. (2007) .Bailey and Scotts Diagnostic Microbiology. 9th ed. Mosby Company. Missouri.
14. Blondel-Hill, E., Henry, E. A. & Speert, D. P. (2007). Pseudomonas. In Manual of Clinical Microbiology, 9th edn, pp. 734–748. Edited by P. R. Murray, E. J. Baron, J. H.
Jorgensen, M. L. Landry & M. A. Pfaller. Washington, DC: American Society for Microbiology.
15. Cathcart, G. R., Quinn, D., Greer, B., Harriott, P., Lynas, J. F., Gilmore, B. F., & Walker, B. (2011). Novel inhibitors of the Pseudomonas aeruginosa virulence factor LasB: a potential therapeutic approach for the attenuation of virulence mechanisms in pseudomonal infection. Antimicrobial agents and chemotherapy, 55(6), 2670-2678.
16. Collee, J. G., Fraser, A. G., Marmino, B. P., & Simons, A. (1996). Mackin and McCartney Practical Medical Microbiology. The Churchill Livingstone. Inc. USA.
17. Dadzie, I., Quansah, E., Puopelle Dakorah, M., Abiade, V., Takyi-Amuah, E., & Adusei, R. (2019). The Effectiveness of Dipstick for the Detection of Urinary Tract Infection. Canadian Journal of Infectious Diseases and Medical Microbiology, 2019.
18. Diggle, S. P., & Whiteley, M. (2020). Microbe Profile: Pseudomonas aeruginosa:
opportunistic pathogen and lab rat. Microbiology, 166(1), 30.
19. Faraji Fatemeh, Mahzounieh Mohammadreza , Ebrahimi Azizollah, Fallah Fatemeh, Teymournejad Omid, Lajevardi Behnaz, 2016. Molecular detection of virulence genes in Pseudomonas aeruginosa isolated from children with Cystic Fibrosis and burn wounds in Iran, Microb Pathog. 99:1-4. doi: 10.1016/j.micpath.2016.07.013.
20. Forbes, B. A.; Sahm, D. F. and Weissfeld, A. S. (2002). Bailey and Scott, S. Diagnostic Microbiology. 11th ed. Mosby Company. Missouri. 7(9): 384-398.
21. Gellatly, S. L., & Hancock, R. E. (2013). Pseudomonas aeruginosa: new insights into pathogenesis and host defenses. Pathogens and disease, 67(3), 159-173.
22. Harris, D. M. (1969). Staining of urinary leucocytes as an aid to the diagnosis of inflammation in the urinary tract. Journal of clinical pathology, 22(4), 492-495.
23. Ironmonger, D., Edeghere, O., Bains, A., Loy, R., Woodford, N., & Hawkey, P. M.
(2015). Surveillance of antibiotic susceptibility of urinary tract pathogens for a population of 5.6 million over 4 years. Journal of Antimicrobial Chemotherapy, 70(6), 1744-1750.
24. Laosu-angkoon, S. (2013). The sensitivity and specificity of a urine leukocyte esterase dipstick test for the diagnosis of urinary tract infection in the outpatient clinic of Rajavithi Hospital. Journal of the Medical Association of Thailand= Chotmaihet thangphaet, 96(7), 849-853.
25. McFadden, J. F. (2000). Biochemical Tests for Identification of Medical Bacteria, 3rd edn., Philadelphia: Lippincott Williams & Wilkins.
26. Mortimer, P. S.; Heinz S.; Hans, G. T.; Albert B. and Hans, G. S. (1981). The prokaryotes a handbook on habitats, isolation and identification of bacteria. Springer- Verlag. Berlin Heidelberg New York, vol. II.
27. Nader, Mohamed Ibrahim. Ibrahim, Jamal Abdul Rahman. Sweidawi, Wissam Karim (2017). Genetic diagnosis of Opr I and Opr L genes in Pseudomonas aeruginosa isolated
28. Nakayama, Y., Yamaguchi, H., Einaga, N., & Esumi, M. (2016). Pitfalls of DNA Quantification Using DNA-Binding Fluorescent Dyes and Suggested Solutions. PloS one, 11(3): e0150528.
29. Newman, J. W., Floyd, R. V., & Fothergill, J. L. (2017). The contribution of Pseudomonas aeruginosa virulence factors and host factors in the establishment of urinary tract infections. FEMS Microbiology Letters, 364(15).
30. Sabharwal, N., Dhall, S., Chhibber, S., & Harjai, K. (2014). Molecular detection of virulence genes as markers in Pseudomonas aeruginosa isolated from urinary tract infections. International journal of molecular epidemiology and genetics, 5(3), 125.
31. Selim, S., El Kholy, I., Hagagy, N., El Alfay, S., & Aziz, M. A. (2015). Rapid identification of Pseudomonas aeruginosa by pulsed-field gel electrophoresis. Biotechnology & Biotechnological Equipment, 29(1), 152-156.
32. Silby, M. W., Winstanley, C., Godfrey, S. A. C., Levy, S. B., & Jackson, R. W. (2011).
Pseudomonas genomes : diverse and adaptable. FEMS Microbiol Rev, 35, 652–680.
33. Simerville, J. A., Maxted, W. C., & Pahira, J. J. (2005). Urinalysis: a comprehensive review. American family physician, 71(6), 1153-1162.
34. Rauf, Muhammed's promise. Tawfiq, Shamiran Muhammad. (2014). Screening for some virulence genes plcH, plcN, exoS in Pseudomonas aeruginosa isolated from the urinary tract. Tikrit University Journal of Pure Sciences, 19 (6) 2014. Pages 66-72. (in Arabic).
35. Rodriguez MJ, Rodriguez A, Maranon R. (2011).Gram stain as a predictor of urinary infections in children under 2 years. Indian pediatrics, 48(10): 816- 817.
36. Rundell E A,Commodore N,Goodman A L, Kazmierczak B I, 2020. A Screen for Antibiotic Resistance Determinants Reveals a Fitness Cost of the Flagellum in Pseudomonas aeruginosa, J Bacteriol; 25;202(6):e00682-19. doi: 10.1128/JB.00682-19.
Print 2020 Feb 25.
37. Tadesse, A. and Alem, M. (2006). Medical Bacteriology. EPHTI.Gondar University.
38. Tang, Y. and Stratton, C.W. (2006). Advanced Techniques in Diagnostic Microbiology Springer Science and Business Media, LLC. Printed in the United States of America.
(TB/EB). 9: 7.
39. Todar, K. (2011). Pseudomonas aeruginosa. Textbook of Bacteriology. Science Magazine V. 304:1421.
40. Ullah, W., Qasim, M., Rahman, H., Jie, Y., & Muhammad, N. (2017). Beta-lactamase- producing Pseudomonas aeruginosa: phenotypic characteristics and molecular identification of virulence genes. Journal of the Chinese Medical Association, 80(3), 173- 177.
