Bacteriological and Molecular Study for Detection of Virulence Genes in Pseudomonas aeruginosa Isolated from
Burns and Wounds Infections
Nabaa abd ali ganem*1, Bushra Hindi Saleh2, Hasan A. Aal Owaif3 1,2,3 College of Biotechnology, Al-Nahrain University, Baghdad, Iraq
*Corresponding Author, e-mail: [email protected] Abstract
During this study a total of (250) samples were collected from patients suffering from burns and wound infections from three hospitals in Baghdad during the period from (1/9/2019) to (30/12/2019). The isolates were firstly identified by a microscopic examination and their cultural characteristics on different selective media, then finely identified by VITEK-2 system. Results revealed that only 120 isolates (48%) of them were gave a typical morphological characteristic and biochemical test that belong to P. aeruginosa isolates. The molecular study included the detection of virulence genes toxA and exoS in P. aeruginosa isolates by colony PCR technique.
Results revealed that toxA and exoS genes were found nearly in all P. aeruginosa isolated from burn and wounds infections, the toxA gene was detected in 27/30(90%) of isolates. Also, exoS gene was found in 26/30 (86.7%) of isolates.
Introduction
Burn wound infections (BWI) are one of the most common health problems and a major source of morbidity and mortality throughout the world. These infections lead to delay the healing of wound, increase the scarring and favor microorganisms proliferation, then result in invasive infections (WHO, 2006). A highly susceptible infection in burn wounds results from a loss of skin integrity and the reduction of immunity that mediated by the immune cells, also it’s affected by the depth and extent of the burn injury, host factors, the virulence and amount of the microbial flora that colonizing the wound (Barajas‐Nava et al., 2013). The skin is exposed to damage by thermal, mechanical and chemical factors, such as scalding or fires, flammable liquids and other sources of heat, electricity, sunlight, chemical , also may infrequently caused by nuclear radiation (Roshangar et al., 2019). The popular local signs of invasive burn infection are the appearance of focal, multifocal, or generalized dark brown, black or violaceous discoloration of the wound, including exchange of an area of partial thickness injury to full-thickness necrosis or necrosis of once viable tissue in an unexcused wound bed (Skariyachan et al., 2018). The
most popular pathogens isolated from burn wounds are Staphylococcus aureus, Pseudomonas aeruginosa, Acinetobacter spp., coliforms, Streptococcus pyogenes, also others pathogens like anaerobic bacteria (Bora and Dhar, 2018).
Pseudomonas aeruginosa is a member of the gamma Proteobacteria a class of bacteria. It’s a gram-negative, aerobic, non-spore forming rod measuring about 0.5to 0.8 µm by 1.5 to 3.0 µm.
It’s belonging to the bacterial family Pseudomonadaceae (Zhapouni et al., 2009). The infections caused by P. aeruginosa are particularly problematic because it’s resistant to antibiotics types and can acquire resistance to all effective antimicrobial drugs (Pachori et al., 2019). To successfully stay on host tissues, P. aeruginosa needs to attach, digest, infect the underlying cell layers and eventually spread to distant tissue sites to avoid nutrient exhaustion and to escape from the local immune surveillance (Laventie et al., 2019).
P. aeruginosa has many virulence factors such as LPS, alkaline Proteases, Elastase, Pyoverdine, Pyocyanin, Flagellum, Type IV Pili, Biofilm Formation, Exoenzym S and Exotoxin A. These are most important virulence factors that work together in different manners in induction of the immune system (Rocha et al., 2019). Exotoxin A (ETA) is an extremely toxic virulence factor released by P. aeruginosa into the extracellular medium by the T2SS system (Michalska and Wolf, 2015). exoA gene encodes (ETA), that causes ADP ribosylation of eukaryotic elongation factor 2 and leading to inhibition of protein synthesis, which has the same mechanism of action as the diphtheria toxin. ETA is a main virulence factor of P. aeruginosa in burn ward of hospitalized patients (Aljebory, 2018). P. aeruginosa exoenzyme S (ExoS) is a bifunctional cytotoxin 49-kDa, type III secretion (TTS) effector, which includes both a GTPase-activating protein (GAP) activity toward the Rho family of low molecular weight G proteins and an ADP- ribosyltransferase (ADPR) activity that targets LMWG proteins in the Rab, Ras, and Rho families. ExoS was encode on exoS gene (Rucks, 2005). Both Rho-GAP and ADPR activities will change host cell cytoskeletal function, that resulting in impaired cell migration and adhesion, disruption epithelial cell barriers and preventing wound healing (Sun et al., 2012).
Materials and Methods Samples collection
A total of (250) samples were collected from patients suffering from burn and wounds infections from three hospitals in Baghdad: Al-Imamein kadhimein medical city, Al-Yarmouk teaching and
Al-Karkh general hospitals during the period from (1/9/2019) to (30/12/2019). The samples were taken from both gender by a sterile cotton swaps, then directly diagnosed on different selective media and finally identified by VITEK-2 system.
Molecular study
In this study from a total of (120) isolates that related to P. aeruginosa only (30) isolates were screened for the presence of exoS and toxA virulence genes by using of a specific primers, as shown in Table (1-1). In colony PCR technique a single colony of bacterial isolate was taken from the nutrient agar plate and was added to the PCR mixture in place of purified template DNA (Aal Owaif, 2017). The PCR tube was consisted of primers, nuclease- free water and master mix. The total volume of PCR mixture was 20μl. Then the PCR tubes were transferred to the thermal cycler to initiate the amplification reaction according to specific program for each pair of primers, as shown in Table (1-2).
Table (1-1): Primers of virulence genes.
Bacteria Gene Primer sequence (5′→3′) Product size (bp)
References
P. aeruginosa
exoS F:CGTCGTGTTCAAGCAGATGGTGCTG R:CCGAACCGCTTCACCAGG
444 bp (Fazeli & Momtaz, 2014)
toxA F:GGCTATGTGTTCGTCGGCTA R:TGATCGCCTGTTCCTTGTCG
487 bp (AlKaaby, 2015)
Table (1-2): PCR amplification program of toxA and exoS virulence genes.
Steps No. of cycles Time (M:S) Temperature
Initial denaturation 1 cycle 5 min 95 ºC
Denaturation
30 cycle
30 second 95 ºC
Annealing 30 second
toxA =58 ºC
exoS=55ºC
Extension 30 second 72 ºC
Final extension 1 cycle 7min 72 ºC
Results and discussion
Isolation of Pseudomonas aeruginosa isolates
Results revealed that among the total of 250 samples, only 120 (48%) isolates were given identical morphological characteristics that belong to Pseudomonas aeruginosa isolates. while the rest isolates were belong to other pathogenic bacteria from different genera such as Staphylococcus aureus, K. pneumoniae, Proteus mirabilis, Escherichia coli, Acinetobacter baumannii and Enterococcus faecium. 53 isolates (44.16%) of them were from male and 39 isolates (32.5%) were from female, their ages were ranging between (18-75) years for both gender. Also the results revealed that 28 isolates (23.3%) of them were from children between (1-10) years.
The results of isolation in this study has been matched with Honnegowda et al., (2019) who reported that a total of 737 wound swabs were taken from patients in the intensive care unit.
Various M.o. has been isolated from these samples included Pseudomonas aeruginosa at ratio (35.3%), Klebsiella pneumoniae (28.5%), Escherichia coli (22.6%), followed by Staphylococcus epidermidis (20.8%) and Proteus mirabilis (9.3%). A study by Ghai et al., (2015) showed that P.
aeruginosa was most frequent pathogen isolated from surgical wound infections, at ratio (55.45%) followed by K. pneumoniae (22.1%) also A. baumannii, P. mirabilis and S. aureus has been isolated at different ratio. A study by Aljanaby and Aljanaby , (2018) who was collected out of 295 burn swabs, 513 different bacterial strains were isolated from patients with burn infection stay at hospital. 335 isolates (65.3%) were gram negative bacteria and178 isolates (34.7%) were gram positive bacteria. Pseudomonas aeruginosa was one of the mainly common bacteria causing burn infection at ratio (41.34%), followed by methicillin resistant S.aureus (20.6%), K.
pneumoniae (18.2%), E.coli (12%) and A. baumannii (7.2%).
A study by Chaudhary et al., (2019), who recorded that out of 109 swab were taken from burn wound patients. 55% of samples were taken from male while 45% of them were from female, their ages between (10-75) years. The most common bacteria isolated from these patients were Pseudomonas aeruginosa (24.95%), followed by Staphylococcus aureus (24.05%), Klebsiella pneumoniae (17.09%), Acinetobacter (15.19%), Escherichia coli (8.23%) and Proteus (4.43%).
Also a study in Basra city in Iraq revealed that among a total of 267 burn samples collected, (44%) of them were from children under 10 years old because children at this age are likely to be more active and play in the kitchen so may exposed to fire places, stoves, hot kitchen appliances and hot liquid (Al-Shamsi and Othman, 2017). In general the reason for variation in bacterial isolated from burn wound infection in all studies may be due to the percentage of distribution of isolates that differs according to the place of clinical samples collection, environmental factors, virulence factors (Ogunseilan, 2005). Also the high prevalence rate of bacterial isolation may be due to factors related to the acquisition of nosocomial pathogens in patients with repeated or long-term hospitalization, prior administration of antimicrobial agents, complicating illnesses, or the immunosuppressive effects of burn trauma (Magneti et al ., 2013).
Detection of virulence genes by colony PCR
The results exhibited here show that 27/30 isolates (90%) have the toxA gene with amplified size 487 bp, as shown in figure (1-1). Also the results revealed that 26/30 isolates (86.7%) have the exoS gene with amplified size 444 bp, as shown in figure (1-2).
Figure (1-1):Colony PCR screening of toxA gene. (Agarose 1%, 10min, at 100 volts then lowered to 70 volts, 60min). Lane (M): 100bp DNA, while the other lanes represent toxA
gene screened by toxA-F and toxA-R primers.
Figure (1-2):Colony PCR screening of exoS gene. (Agarose 1%, 10min, at 100 volts then lowered to 70 volts, 60min). Lane (M): 100bp DNA Ladder, while the other lanes represent exoS gene screened by exoS-F and exoS-R primers.
This result is consistent with the result of Chand et al. )2020( who recorded that (95.4%) of P.
aeruginosa isolates carry the toxA gene. Exotoxin A encoded by the toxA gene that produced by P. aeruginosa inhibits protein biosynthesis by transferring an ADP-ribosyl moiety to elongation factor 2 of the host cell by stopping elongation of polypeptide chains. A study by Aljebory, (2018) from Iraq showed that toxA gene was found in (100%) of burns and wounds patients.
Other studies by Haghi et al., (2018) and Aljebory, (2019) demonstrated that (97.8%) and (100%) respectively of the isolates were positive for toxA gene. Exotoxin A is an extracellular enzyme that is produced by most clinical strains of P. aeruginosa (Michalska and Wolf, 2015).
The gene encoding Exotoxin A is found in 90-95% of P.aeruginosa (Matar et al., 2002). toxA plays an important role in the spreading of P. aeruginosa within the burned skin and had a special role in retardation of wound healing and contraction, and contribute to the overall virulence of P.aeruginosa in those burned patients (El-Din et al., 2008).
A study, in hospitals of Baghdad by Ali et al., (2020) who reported that exoS was the most frequent gene that was detected in (87%) isolates. Whereas study submitted by Al-Khafaji, (2014) from Iraq revealed showed that (80.0%) P. aeruginosa isolated from burn infection harbored exoS gene. The exoS gene is encoded for production of exoenzyme S (adenosine diphophate ribosyl tarnsferase) which is an important enzyme that transfer the ADP-ribose moiety from NAD+ to many eukaryotic cellular proteins and exoS is secreted by a type-III secretion system directly into the cytosol of epithelial cells for inhibiting the protein synthesis
and disrupting endocytosis, the actin cytoskeleton, and cell proliferation, so resulting in apoptosis in the host cells (Fu et al., 1993; 2009;Sawa, 2014). exoS gene plays an essential role in burns infection by contributing dissemination of bacteria (Jabalameli et al., 2012), also the secretion of exoenzyme S by P. aeruginosa inhibits wound repair and effect on the host innate immune response to aid its colonization and its ability to cause injury (Stirling et al., 2006).
Conclusion: P. aeruginosa isolates were predominant bacteria isolated from patients suffering from burn and wounds infections. toxA and exoS genes were found nearly in all P. aeruginosa isolated from burn wounds infections.
References
1. Aal Owaif, H. A. H. (2017). Regulation of Transcription of the Escherichia coli Group 2 Capsule Gene Clusters. PhD thesis, University of Manchester (UK).
2. Ali, A.M.; Al-Kenanei, K.A. and Bdaiwi, Q.O. (2020). Molecular study of some virulence genes of Pseudomonas aeruginosa isolated from different infections in hospitals of Baghdad.
Rev. Med. Microbiol. 31(1):26-41.
3. Aljanaby, A.A. and Aljanaby, I.A. (2018). Prevalence of aerobic pathogenic bacteria isolated from patients with burn infection and their antimicrobial susceptibility patterns in Al-Najaf City, Iraq-a three-year cross-sectional study. F1000Res. 7(1157):1-14.
4. Aljebory, I.S. (2018). PCR detection of some virulence genes of Pseudomonas aeruginosa in Kirkuk city, Iraq. Int. J. Pharm. Sci. Res. 10(5):1068-1071.
5. Aljebory, I.S. (2019). Genetic Detection and Identification of Some Virulence Factors Genes Among Pseudomonas aeruginosa Samples in Kirkuk province-Iraq. Int. J. Pharm. Clin. Res.
10(03):147-150.
6. Al-Khafaji, N.S. (2014). Molecular Study of Some Virulence Factors among Pseudomonsa aeruginosa Recovered from Burn infection, Iraq. Int. J. Med. Res. Pharm. Sci. 4(3):71-80.
7. Al-Shamsi, M. and Othman, N. (2017). The epidemiology of burns in Basra, Iraq. Ann.
Burns Fire Disasters. 30(3):167–171.
8. Barajas‐Nava, L.A.; López‐Alcalde, J.; i Figuls, M.R.; Solà, I. and Cosp, X.B. (2013).
Antibiotic prophylaxis for preventing burn wound infection. Cochrane Database. Syst. Rev.
(6):1-174.
9. Bora, M. and Dhar, D. (2018). Bacteriological Profile (Aerobic) of Burn Wound Infection
with Its Antibiotic Sensitivity Testing in Silchar Medical College and Hospital. Int. J. Curr.
Microbiol. App. Sci. 7(7):2130-2139.
10. Chand, Y.; Khanal, S.; Panta, O.P.; Shrestha, D.; Khadka, D.K. and Poudel, P. (2020).
Prevalence of some virulence genes and antibiotic susceptibility pattern of Pseudomonas aeruginosa isolated from different clinical specimens.1-12
11. Chaudhary, N.A.; Munawar, M.D.; Khan, M.T.; Rehan, K. and Sadiq, A. (2019).
Epidemiology, bacteriological profile, and antibiotic sensitivity pattern of burn wounds in the burn unit of a tertiary care hospital. Cureus. 11(6):1-7.
12. El-Din, A.B.; EL-Nagdy, M.A.; Badr, R.A.W.I.A. and EL-Sabagh, A.M. (2008).
Pseudomonas aeruginosa exotoxin A: its role in burn wound infection and wound healing.
Egypt. J. Plast. Reconstr. Surg. 32:59-65.
13. Fu, H.; Coburn, J. and Collier, R.J. (1993). The eukaryotic host factor that activates exoenzyme S of Pseudomonas aeruginosa is a member of the 14-3-3 protein family. Proc.
Natl. Acad. Sci. 90(6):2320-2324.
14. Ghai, S.; Sachdeva, A.; Mahajan, R.; Dogra, S.; Soodan, S. and Mahajan, B. (2015).
Bacteriological and antibiotic susceptibility profile of aerobic burn wound isolates at a tertiary care institute in Northern India. J. Appl. Environ. Microbiol. 3(4):95-100.
15. Haghi, F.; Zeighami, H.; Monazami, A.; Toutouchi, F.; Nazaralian, S. and Naderi, G.
(2018). Diversity of virulence genes in multidrug resistant Pseudomonas aeruginosa isolated from burn wound infections. Microb. Pathog. 115:251-256.
16. Honnegowda, T.M.; Kumar, P., Udupa, P. and Rao, P. (2019). Epidemiological study of burn patients hospitalised at a burns centre. Manipal. Int. Wound. J. 16(1):79-83.
17. Jabalameli, F.; Mirsalehian, A.; Khoramian, B.; Aligholi, M.; Khoramrooz, S.S.;
Asadollahi, P.; Taherikalani, M. and Emaneini, M. (2012). Evaluation of biofilm production and characterization of genes encoding type III secretion system among Pseudomonas aeruginosa isolated from burn patients. Burns. 38(8):1192-1197.
18. Laventie, B.J.; Sangermani, M.; Estermann, F.; Manfredi, P.; Planes, R.; Hug, I.;
Jaeger, T.; Meunier, E.; Broz, P. and Jenal, U. (2019). A surface-induced asymmetric program promotes tissue colonization by Pseudomonas aeruginosa. Cell Host Microbe.
25(1):140-152.
19. Magneti, M.H. ;Arongozeb , M.D.; Muktadir, K. and Ahmed Z. (2013). Isolation and
identification of different bacteria from different types of burn wound infections and study their antimicrobial sensitivity pattern. Int. J. Res. Applied, Natural and Social Sci. 1 (3): 125- 132.
20. Matar, G.M.; Ramlawi, F.; Hijazi, N.; Khneisser, I. and Abdelnoor, A.M. (2002).
Transcription levels of Pseudomonas aeruginosa exotoxin A gene and severity of symptoms in patients with otitis externa. Curr. Microbiol.45(5): 350-354.
21. Michalska, M. and Wolf, P. (2015). Pseudomonas Exotoxin A: optimized by evolution for effective killing. Front. microbiol. 6(963):1-7.
22. Michalska, M. and Wolf, P. (2015). Pseudomonas Exotoxin A: optimized by evolution for effective killing. Front. microbiol. 6(963):1-7.
23. Ogunseilan, O. (2005)."Microbial Diversity, form and function in prokaryotes". 1st (ed.), Blackwell. USA.
24. Pachori, P., Gothalwal, R. and Gandhi, P. (2019). Emergence of antibiotic resistance Pseudomonas aeruginosa in intensive care unit; a critical review. Genes. dis. 6(2):109-119.
25. Rocha, A.J.; Barsottini, M.R.; Rocha, R.R.; Laurindo, M.V.; Moraes, F.L. and Rocha, S.L. (2019). Pseudomonas aeruginosa: Virulence Factors and Antibiotic Resistance Genes. Braz. Arch. Biol. Technol. 62:1-15.
26. Roshangar, L.; Soleimani, J.R.; Kheirjou, R.; Reza, M.R. and Ferdowsi, A.K. (2019).
Skin Burns: Review of Molecular Mechanisms and Therapeutic Approaches. Wounds.
31(12):308-315.
27. Rucks, E.A. (2005). Role of the host cell in the type III translocation of Pseudomonas aeruginosa exoenzyme S. Phd Thesis, West Virginia University.
28. Sawa, T. (2014). The molecular mechanism of acute lung injury caused by Pseudomonas aeruginosa: from bacterial pathogenesis to host response. J. Intensive Care. 2(1):1-11.
29. Skariyachan, S.; Sridhar, V.S.; Packirisamy, S.; Kumargowda, S.T. and Challapilli, S.B. (2018). Recent perspectives on the molecular basis of biofilm formation by Pseudomonas aeruginosa and approaches for treatment and biofilm dispersal. Folia.
Microbiol. 63(4):413-432.
30. Stirling, F.R.; Cuzick, A.; Kelly, S.M.; Oxley, D. and Evans, T.J. (2006). Eukaryotic localization, activation and ubiquitinylation of a bacterial type III secreted toxin. Cell.
Microbiol. 8(8):1294-1309.
31. Sun, Y.; Karmakar, M.; Taylor, P.R.; Rietsch, A. and Pearlman, E. (2012). ExoS and ExoT ADP ribosyltransferase activities mediate Pseudomonas aeruginosa keratitis by promoting neutrophil apoptosis and bacterial survival. J. Immun. 188(4):1884-1895.
32. World Health Organization. (2006). Facts about injuries: burns. WHO and Inter. Soc.
Burns Injuries. Geneva. Switzerland.
33. Zhapouni, A.; Farshad, S. and Alborzi, A., (2009). Pseudomonas aeruginosa: Burn infection, treatment and antibacterial resistance. Iran. Red. Crescent. Med. J. 11(3):244-253.
