Morphological and Molecular Study of Hymenolepis Sp. From House Rats in Baghdad/Iraq through Mitochondrial Cox1 and ITS1 Gene PCR Analysis
Shaymaa A. Majeed , Amer Murhum Al-Amery
Department of Parasitology, College of Veterinary Medicine, University of Baghdad/Iraq.
[email protected] Abstract
Rodents are popular companion animals and they can be reservoirs of many parasites of zoonotic pathogens. The occurrence of Hymenolepis nana and H. diminuta in rodents from variety cities from Baghdad/Iraq Totally, 100 fecal samples were collected from Rats. The fecal samples were examined by direct and different fecal diagnostic techniques. The total prevalence of parasitic infection was 25(25%), H. diminuta were detected in 18(18%) while H. nana were detected in 7(7%). Higher prevalence 11(40.74%) were found in Abu Ghraib area with significant differences (p≤ 0.01). Our results revealed differences in the infection rates of Rat Hymenolepiasis according to sex. The present study showed relatively male was higher prevalence than female. The reported of Rat Hymenolepiasis increased in September than the other month which decreased in December and no infection in November. Ten samples with positive PCR products in any of the DNA regions include Hymenolepis sp mitochondrial cox1 gene, Hymenolepis nana 18S rRNA-ITS1 gene and Hymenolepis diminuta 18S rRNA-ITS1 gene gave profiles characteristic of H. nana and H.
diminuta. The results imply the risk of zoonotic transmission of Hymenolepiasis in Baghdad.
Particular attention should be given to hygiene level maintained and disposal rodents for avoid parasite transmission to humans.
Keyword: prevalence, Hymenolepis nana, hymenolepis diminuta, Rat, Molecular diagnosis Introduction
Hymenolepiasis is one of a largely rodent-borne group of parasitic diseases caused by cestodes belonging to the family of cyclophyllidae tapeworms, Hymenolepididae, and is included in the list of neglected zoonotic helminthoses (Thompson 2015). Rodents are the main definitive hosts of both Hymenolepis nana and H. diminuta, which are zoonotic and known as the dwarf and rat tapeworms, respectively (Steinmann et al., 2012). H. nana is the most common cestode infecting humans, whereas H. diminuta causes occasional human infections (Soares Magalhães et al., 2013).
Both cestodes can be differentiated by the morphology. Scolex of H. nana consists of four suckers and a retractable rostellum armed with hooks, whereas the scolex of H. dimunita has four suckers similar to that of H. nana and is unarmed. H. nana and H. diminuta are two commonly occurring cestodes causing hymenolepiasis in rodents and humans especially young children (Sood et al., 2018).
H. nana and H. diminuta have been detected in brown rats in many countries and areas. H.
nana has been found in the Netherlands; 3.3% (1/30) in farms and 4.1% (2/49) in rural environments Franssen et al. (2016); 8.8% (10/112) in Brazil Simões et al. (2016). H. diminuta has been found in the Netherlands; 50% (15/30) in farms, 10.2% (5/49) in rural environments, and 10.5% (4/38) in suburban environments Franssen et al. (2016); 6.3% (2/32) in Taiwan Tung et al.
(2013) and Goswami et al., (2011) who diagnosed positive for spontaneous Hymenolepis diminuta infection was78 (19.23%) in adult laboratory and wild rats investigated for parasitic diseases.
Majeed. (2016) who mention that the prevalence rate of Hymenolepis nana 4(6.34%), while Hymenolepis diminuta 2(3.17%) in Baghdad/ Iraq.
In the diagnosis of Hymenolepiasis and differentiation of causative species, eggs recovered from host feces usually play an important role for identifying their morphological features (Nkouawa et al., 2016). However, PCR-based molecular techniques not only increase detection rates of parasites, but also provide the accurate species differentiation and their genetic characterizations, currently; the first and second internal transcribed spacer regions (ITS1 and ITS2) of nuclear ribosomal RNA gene can be helpful for resolving remarkable taxonomic issues and dis- criminating closely related genera and species, Meanwhile, mitochondrial (mt) genome sequences have been proven to be useful and reliable genetic markers for population genetics and systematic studies (Sharma et al., 2016 and Shahnazi et al 2019). The aim of this study was to estimate the prevalence of Hymenolepis nana and H. diminuta parasites in Rat and to evaluate its risk on Human in Baghdad governorate/ Iraq.
Material and method Samples collection
One hundred rats are trap from some districts in Baghdad city include (Bakeries, Grain storage factory and farm in Abu Ghraib area, Al-Amiriya area including veterinary medicine/
university Baghdad , Al-Sha'ab area and Haifa Street area). All samples of rat is then bringing to laboratory and examined 5grams of fecal samples immediately the following morning. Fecal sample examined (about 7 to18 samples/ month) in parasites laboratory for detecting eggs and worms (Hymanolepis spp.). The samples are dividing into two parts: first part for microscopically examination and second part for DNA extraction.
Dissection and collection of parasites:
Trapped rats is kill humanely by anesthesia (9:1, ketamine and xylasine) per 100 gm. rat body weight after were caught from tail and interperitoneal injection as accorded by (Struck et al., 2011).Stool samples fixed in formalin were processed using the formalinethyl acetate concentration technique to detect eggs, Cestodes were collected directly from the intestine and kept in separate plastic containers, and the samples were transported to Parasitology Laboratory located at the College of Veterinary Medicine, University of Baghdad for examination (Al- Zubaidei and Kawan 2020). So the permanent slides were prepared and stained with acetocarmine acide, dehydrated in different grades of alcohols, cleared in xylene and mounted in Canada balsam. After those cestodes were morphologically identified under microscope using the taxonomic keys described previously (Palmer et al., 2011).
Diagnosis by use conventional PCR:- DNA extraction
PCR technique was performed for detection Hymenolepis species based mitochondrial cox1 gene and specific detection Hymenolepis nana and Hymenolepis diminuta based 18S rRNA-ITS1 gene from Rat stool samples. This method was carried out according to method described by (Kandil et al., 2010). Worm DNA from stool samples were extracted by using genomic DNA from worm tissue samples were extracted by using gSYAN DNA mini kit extraction kit (Tissue protocol) Geneaid. USA, and done according to company instructions. Also Cestode tissue samples were fixed and preserved in 70–100% ethanol and DNA extracted using gSYAN DNA mini kit extraction kit (Tissue protocol) Geneaid. USA, and done according to company instructions.
Amplification was performed using specific primers Hymenolepis sp. mitochondrial cox1 gene:
F:5`ACTTCATTGCTTTTGCTTTTTAGA3`R:5`TGCTGTCATAAATGAACCAACAGT3` with PCR product size ~700bp (Kandil et al., 2010). Hymenolepis nana 18S rRNA-ITS1 gene:
F:5`GTTAGGCCTGCATGTTGTGC3`R:5`TGTGTGCCAGCTTGTGTGTA3`with PCR product
size 535bp (This study Genbank:AF461124.1) and Hymenolepis diminuta 18S rRNA-ITS1 gene: F:
5` TGCAGCCAACTGCTGTGATA3`R: 5`GGGGGAGCATGTGTCAAAGT3` PCR product size 361bp. PCR master mix preparation by DNA template 5-50ng with Volume 5µL, Cox1 gene Forward primer (10pmol) with 1µL, Cox1 gene Reverse primer (10pmol) with 1µL and PCR water 13µL. then placed in standard Maxime PCR PreMix that containing all other components which needed to PCR reaction such as (Taq DNA polymerase, dNTPs, Tris-HCl pH: 9.0, KCl, MgCl2, stabilizer, and tracking dye). Then, all the PCR tubes were transferred into Exispin vortex centrifuge at 3000rpm for 3 min. Then placed in PCR Thermocycler by using conventional PCR thermocycler system at step: Initial Denaturation 95ºC at 5min for 1 repeat, Denaturation 95 ºC at 30sec, Annealing 58 ºC at 30sec, Extension 72 ºC at 2min for 35 cycle and Final extension 72 ºC at 5min for 1 repeat.
DNA sequencing and phylogenetic analysis
DNA sequencing and phylogenetic analysis PCR products of cox1 were purified and sequenced using both forward and reverse complements by Genetic Analyzer. A multiple sequence alignment was generated for the samples using the ClustalW (Thompson et al., 1994). A BLAST search was performed for each sequence to locate related sequences. The Phylogenetic tree analysis based cytochrome c oxidase subunit 1 (cox1) gene partial sequence in local Rat Hymenolepis diminuta isolates that used for genetic relationship analysis. The phylogenetic tree was constructed using Unweighted Pair Group method with Arithmetic Mean (UPGMA tree) in (MEGA 6.0 version). The local Hymenolepis diminuta isolates (MW454851.1 , MW454848.1, MW454845.1, and MW454844.1) were showed closed related to NCBI-BLAST Hymenolepis diminuta Iran isolates at total genetic changes (0.4-0.010%) (Figure 8).So the Phylogenetic tree analysis based cytochrome c oxidase subunit 1 (cox1) gene partial sequence in local Rat Hymenolepis nana isolates that used for genetic relationship analysis. The phylogenetic tree was constructed using Unweighted Pair Group method with Arithmetic Mean (UPGMA tree) in (MEGA 6.0 version). The local Hymenolepis nana isolates (MW454842.1) were showed closed related to NCBI-BLAST Hymenolepis nana Egypt isolate. The Hymenolepis nana the local Hymenolepis nana isolates (MW454843.1, MW454846.1, MW454847.1, and MW454850.1) showed closed related to NCBI- BLAST Hymenolepis nana Japan isolate. Whereas, the local Hymenolepis nana isolates (MW454849.1) showed new variant isolate at total genetic changes (0.025-0.0050%) (Figure 9).
Statistical Analysis:
The Statistical Analysis System- SAS (2012) program was used to detect the effect of difference factors in study parameters. Chi-square test was used to significant compare between percentage (0.05 and 0.01 probability) in this study.
Result
Microscopic Examination
The present study revealed that the rat were infected with two species of cestodes (egg and worm), namely H. nana and H. diminuta. Eggs of H. nana (Fig. 1) are oval or subspehrical and smaller, ranging 44–54 (length) × 38–44 μm (width). On the inner membrane are two poles, from which 4 to 8 polar filaments spread out between the two membranes. The oncosphere has six hooks.
The morphological feature of Hymenolepis nana (fig. 2) are characterized by smallest cestode, scolex of H. nana has four suckers, and an armed rostellum with a single circle of 20 to 30
hooks that is clearly visible. Genital pores are unilateral. H. nana contains both male and female reproductive structures in each proglottid, This contains three testicles and one ovary (Fig. 3).
The tapeworm’s egg of H. diminuta (Fig.4) is round, ringing from 70×80 (length) × 60-70 µm (width) in diameter with hexacanth embyreo and has no polar filaments in the inner shell.
Hymenolepis diminuta are characterized by small in size but larger then H. nana. The scolex of has no hooks (unarmed) but have four suckers (fig. 5).
The prevalence of the H. nana and H. diminuta in the examined fecal samples of all rats was 25(25%) in microscopy examination were infected with Hymenolepiasis of four regions in Baghdad city. Also 18(18%) were infected with Hymenolepis diminuta and 7(7%) were infected with Hymenolepis nana. Higher prevalence 11(40.74%) were found in Abu Ghraib area with significant differences (p≤ 0.01) while lower prevalence 3(12%) was recorded in Al-Sha'ab area. While H.
diminuta is the highest 7(26.92%) in Abu Ghraib with significant differences (p≤ 0.01) and H. nana was 3(13.63%) in Haifa Street with significant differences (p≤ 0.05) (Table1).
The results of this study revealed also differences in the distribution of parasites between sexes. Out of 67 male examined, 19(28.35%) were positive with significant differences (p≤ 0.05), while on the contrary, out of 33 female examined, 6(18.18%) were positive with hymenolepis spp.
Infection number of H. diminuta 14(20.89%) and H. nana 5(7.46%) in male were higher prevalence than female (Table 2).
The prevalence of H. nana and H. diminuta according to months was also appeared between the examined rats. The results of this study revealed high prevalence rate 10(62. 5%) at September with significance differences (p≤ 0.01) than the other month which decreased in December 1(9.09%) and no infection in November. (Table3).
Figure 2: Scolex of H.nana staining Figure 1: Egg of H.nana X40 with carmine stain X4
Figure 3: (A) Gravid and (B) mature segment of Hymenolepis spp. staining with carmine stain X4.
A B
Figure 5:Scolex of H.diminuta
staining with carmine stain X10 Figure 4:Egg of H.diminuta X40
Table (1): Prevalence of rats Hymenolepiasis according to areas of study Area Examination
No.
Infection No.
Percentage (%)
Infection No. of H. nana and Percentage (%)
Infection No. of H. diminuta Percentage (%)
Abu Ghraib 27 11 40.74% 3(11.11%) 8(29.62%)
Al-Ameriya 26 8 30.76% 1(3.84%) 7(26.92%)
Al-Sha'ab 25 3 12% 0(0.00%) 3(12%)
Haifa Street 22 3 13.63% 3(13.63%) 0(0.00%)
Total no. 100 25 25% 7(7%) 18(18%)
Chi-Square (χ2) -- -- 7.39 ** 5.02 * 8.44 **
* (P≤0.05), ** (P≤0.01).
Table (2). Prevalence of rats Hymenolepiasis according to sex Sex Examination
No.
Infection No.
Percentage (%)
Infection No. of H.nana and Percentage (%)
Infection No. of H.diminuta and Percentage (%)
Male 67 19 28.35% 5(7.46%) 14(20.89%)
Female 33 6 18.18% 2(6.06%) 4(12.12%)
Total 100 25 25% 7(7%) 18(18%)
Chi-Square (χ2) -- -- 4.87 * 0.673 NS 4.06 *
* (P≤0.05).
Table (3): Prevalence of rats Hymenolepiasis according to months Months Examination
No.
Infection No.
Percentage (%)
Infection No. of H.nana and Percentage (%)
Infection No. of H.diminuta and Percentage (%)
December 11 1 9.09% 0(0.00%) 1(9.09%)
January 8 1 12.5% 0(0.00%) 1(12.5%)
February 9 1 11.11% 1(11.11%) 0(0.00%)
June 7 1 14.28% 0(0.00%) 1(14.28%)
July 10 2 20% 2(20%) 0(0.00%)
August 13 5 38.46% 0(0.00%) 5(38.46%)
September 16 10 62. 5% 2(12.5%) 8(50%)
October 18 4 22.22% 1(5.55%) 3(16.66%)
November 8 0 0(0.00%) 0(0.00%) 0(0.00%)
Total 100 25 25% 7(7%) 18(18%)
Chi-Square (χ2) -- -- 11.38 ** 8.63 ** 11.52 **
** (P≤0.01).
Molecular analysis
Amplification of cox1 and 18S rRNA-ITS1 gene in H. nana and H. diminuta from rat
It was done in order to detect the presence of hymenolepis genes, and identify the specific genus and species, which using PCR. Then detect the presence of cox1 gene (700bp) region for 100 random isolated the sample. Agarose gel electrophoresis image that showed the PCR product analysis of mitochondrial cytochrome c oxidase subunit 1(cox1) gene in Hymenolepis sp. from Rats feces samples. (Figure: 6) Also agarose gel electrophoresis image that showed the Duplex PCR product analysis of 18S rRNA-ITS1 gene in Hymenolepis nana and Hymenolepis diminuta from Rat stool samples. Where, the Lane (M): DNA marker ladder (1500-100bp) and the Lane (1-20) were showed some positive PCR Hymenolepis nana at 535bp and Hymenolepis diminuta at 361bp duplex PCR product size (Figure: 7).
Multiple sequence alignment analysis of cytochrome c oxidase subunit 1 (cox1) gene in local Rat Hymenolepis diminuta isolates and NCBI-Genbank Hymenolepis diminuta country related isolates. The multiple alignment analysis was constructed using (ClustalW alignment tool.Online).
That alignment analysis was showed the nucleotide alignment similarity as (*) and substitution mutations in cytochrome c oxidase subunit 1 (cox1) gene between isolates. (Figure: 8).
Phylogenetic tree analysis based cytochrome c oxidase subunit 1 (cox1) gene partial sequence in local Rat Hymenolepis diminuta isolates that used for genetic relationship analysis. The phylogenetic tree was constructed using Unweighted Pair Group method with Arithmetic Mean (UPGMA tree) in (MEGA 6.0 version). The local Hymenolepis diminuta isolates (MW454844, MW454845, MW454848 and MW454851) were showed closed related to NCBI-BLAST Hymenolepis diminuta Iran isolates at total genetic changes (0.4-0.010%). Also Multiple sequence alignment analysis of cytochrome c oxidase subunit 1 (cox1) gene in local Rat Hymenolepis nana isolates and NCBI-Genbank Hymenolepis nana country related isolates. The multiple alignment analysis was constructed using (ClustalW alignment tool. Online). That alignment analysis was showed the nucleotide alignment similarity as (*) and substitution mutations in cytochrome c oxidase subunit 1 (cox1) gene between isolates (Figure: 10).
Phylogenetic tree analysis based cytochrome c oxidase subunit 1 (cox1) gene partial sequence in local Rat Hymenolepis nana isolates that used for genetic relationship analysis. The phylogenetic tree was constructed using Unweighted Pair Group method with Arithmetic Mean
(UPGMA tree) in (MEGA 6.0 version). The local Hymenolepis nana isolates (MW454842.1) were showed closed related to NCBI-BLAST Hymenolepis nana Egypt isolate. The Hymenolepis nana the local Hymenolepis nana isolates (MW454843.1, MW454846.1, MW454847.1, and MW454850.1) showed closed related to NCBI-BLAST Hymenolepis nana Japan isolate. Whereas, the local Hymenolepis nana isolates (MW454849.1) showed new variant isolate at total genetic changes (0.025-0.0050%) (Figure; 11).
Figure (6): Agarose gel electrophoresis image that showed the PCR product analysis of mitochondrial cytochrome c oxidase subunit 1 (cox1) gene in Hymenolepis sp. from Rats feces
samples. Where, the Lane (M): DNA marker ladder (1500-100bp) and the Lane (1-22) were showed some positive PCR amplification of (cox1) gene in Hymenolepis sp. at 700bp PCR
product size.
Figure (7): Agarose gel electrophoresis image that showed the Duplex PCR product analysis of 18S rRNA-ITS1 gene in Hymenolepis nana and Hymenolepis diminuta from Rat stool samples. Where, the Lane (M): DNA marker ladder (1500-100bp) and the Lane (1-20) were showed some positive PCR Hymenolepis nana at 535bp and Hymenolepis diminuta at
361bp duplex PCR product size.
MW454844.1 TTGAGTTTAATTCCTGATGCTTTTGGGTTTTATGGGCTCTTGTTTGCCATGTTTTCTATT MK614218.1 TTGAGTTTAATTCCTGATGCTTTTGGGTTTTATGGGCTCTTGTTTGCCATGTTTTCTATT MW454851.1 TTGAGTTTAATTCCTGATGCTTTTGGGTTTTATGGGCTCTTGTTTGCCATGTTTTCTATT MW454848.1 TTGAGTTTAATTCCTGATGCTTTTGGGTTTTATGGGCTCTTGTTTGCCATGTTTTCTATT MW454845.1 TTGAGTTTAATTCCTGATGCTTTTGGGTTTTATGGGCTCTTGTTTGCCATGTTTTCTATT MN536015.1 TTGAGTTTAATTCCTGATGCTTTTGGGTTTTATGGGCTCTTGTTTGCCATGTTTTCTATT KY079338.1 TTGAGTTTAATACCTGACGCTTTTGGATTTTATGGACTTTTATTTGCCATGTTTTCTATT AF096244.2 TTGAGTTTAATACCTGACGCTTTTGGATTTTATGGACTTTTATTCGCCATGTTTTCTATT
*********** ***** ******** ******** ** ** ** ***************
MW454844.1 GTTTGTTTAGGTAGAAGTGTTTGAGGGCATCATATGTTTACTGTTGGTTTAGATGTAAAG MK614218.1 GTTTGTTTAGGTAGAAGTGTTTGAGGTCATCATATGTTTACTGTTGGTTTAGATGTAAAG MW454851.1 GTTTGTTTAGGTAGAAGTGTTTGAGGGCATCATATGTTTACTGTTGGTTTAGATGTAAAG MW454848.1 GTTTGTTTAGGTAGAAGTGTTTGAGGGCATCATATGTTTACTGTTGGTTTAGATGTAAAG MW454845.1 GTTTGTTTAGGTAGAAGTGTTTGAGGGCATCATATGTTTACTGTTGGTTTAGATGTAAAG MN536015.1 GTTTGTTTAGGTAGAAGTGTTTGAGGGCATCATATGTTTACTGTTGGTTTAGATGTAAAG KY079338.1 GTTTGTTTAGGAAGAAGTGTTTGGGGCCATCATATGTTTACTGTTGGTTTAGATGTGAAG AF096244.2 GTTTGTTTAGGAAGAAGTGTTTGGGGCCATCATATGTTTACTGTTGGTTTAGATGTGAAG
*********** *********** ** ***************************** ***
MW454844.1 ACGGCAGTGTTCTTTAGATCTGTAACTATGATTATAGGGGTACCTACAGGAATTAAGGTG
MK614218.1 ACGGCAGTGTTTTTTAGATCTGTAACTATGATTATAGGGGTACCTACAGGAATTAAGGTG MW454851.1 ACGGCAGTGTTCTTTAGATCTGTAACTATGATTATAGGGGTACCTACAGGAATTAAGGTG MW454848.1 ACGGCAGTGTTCTTTAGATCTGTAACTATGATTATAGGGGTACCTACAGGAATTAAGGTG MW454845.1 ACGGCAGTGTTCTTTAGATCTGTAACTATGATTATAGGGGTACCTACAGGAATTAAGGTG MN536015.1 ACGGCAGTGTTCTTTAGGTCTGTAACTATGATTATAGGGGTACCTACAGGAATTAAGGTG KY079338.1 ACGGCAGTGTTCTTTAGGTCTGTAACTATGATTATAGGTGTGCCTACAGGAATTAAGGTG AF096244.2 ACGGCAGTGTTCTTTAGGTCTGTAACTATGATTATAGGTGTGCCTACAGGAATTAAGGTG
*********** ***** ******************** ** ******************
MW454844.1 TTTACTTGGTTATACATGCTTTTAAACTCTAAAGTTAATAAGGGGGATCCTGTTGTTTGA MK614218.1 TTTACTTGGTTATACATGCTTTTAAACTCTAAAGTTAATAAGGGGGATCCTGTTGTTTGA MW454851.1 TTTACTTGGTTATACATGCTTTTAAACTCTAAAGTTAATAAGGGGGATCCTGTTGTTTGA MW454848.1 TTTACTTGGTTATACATGCTTTTAAACTCTAAAGTTAATAAGGGGGATCCTGTTGTTTGA MW454845.1 TTTACTTGGTTATACATGCTTTTAAACTCTAAAGTTAATAAGGGGGATCCTATTGTTTGA MN536015.1 TTTACTTGGTTATACATGCTTTTAAACTCTAAAGTTAATAAGGGGGATCCTGTTGTTTGA KY079338.1 TTTACTTGGTTATATATGCTTTTAAACTCTAAAGTTAATAAGGGTGATCCTGTTGTTTGA AF096244.2 TTTACTTGGTTATATATGCTTTTAAACTCTAAAGTTAATAAGGGTGATCCTGTTGTTTGA
************** ***************************** ****** ********
MW454844.1 TGAATAGTGTCTTTTATCGTGTTATTTAGATTTGGAGGAGTTACAGGAATTATTTTATCT MK614218.1 TGAATAGTGTCTTTTATTGTGTTATTTAGATTTGGAGGAGTTACAGGGATTATTTTATCT MW454851.1 TGAATAGTGTCTTTTATCGTGTTATTTAGATTTGGAGGAGTTACAGGAATTATTTTATCT MW454848.1 TGAATAGTGTCTTTTATCGTGTTATTTAGATTTGGAGGAGTTACAGGAATTATTTTATCT MW454845.1 TGAATAGTGTCTTTTATCGTGTTATTTAGATTTGGAGGAGTTACAGGAATTATTTTATCT MN536015.1 TGAATAGTGTCTTTTATCGTGTTATTTAGATTTGGAGGAGTTACAGGAATTATTTTATCT KY079338.1 TGGATAGTGTCTTTTATTGTGTTATTTAGGTTTGGGGGAGTCACAGGAATTATTTTATCT AF096244.2 TGGATAGTGTCTTTTATTGTGTTATTTAGGTTTGGGGGAGTCACAGGAATTATTTTATCT
** ************** *********** ***** ***** ***** ************
Figure (8): Multiple sequence alignment analysis of cytochrome c oxidase subunit 1 (cox1) gene in local Rat Hymenolepis diminuta isolates and NCBI-Genbank Hymenolepis diminuta
country related isolates. The multiple alignment analysis was constructed using (ClustalW alignment tool.Online). That alignment analysis was showed the nucleotide alignment similarity as (*) and substitution mutations in cytochrome c oxidase subunit 1 (cox1) gene
between isolates.
Figure (9): Phylogenetic tree analysis based cytochrome c oxidase subunit 1 (cox1) gene partial sequence in local Rat Hymenolepis diminuta isolates that used for genetic relationship
analysis. The phylogenetic tree was constructed using Unweighted Pair Group method with Arithmetic Mean (UPGMA tree) in (MEGA 6.0 version). The local Hymenolepis diminuta
isolates (MW454844, MW454845, MW454848 and MW454851) were showed closed related to NCBI-BLAST Hymenolepis diminuta Iran isolates at total genetic changes (0.4-0.010%).
AP017666.1 GGTATTATAGGTCATATATGTTTAAGATTGAGTTTAATTCCTGATGCTTTTGGGTTTTAT MW454850.1 GGTATTATAGGTCATATAAATTTAAGATTGAGTTTAATTCCTGATGCTTTTGGGTTTTAT MW454846.1 GGTATTATAGGTCATATATGTTTAAGATTGAGTTTAATTCCTGATGCTTTTGGGTTTTAT MW454843.1 GGTATTATAGGTCATATATGTTTAAGATTGAGTTTAATTCCTGATGCTTTTGGGTTTTAT MW454847.1 GGTATTATAGGTCATATATGTTTAAGATTGAGTTTAATTCCTGATGCTTTTGGGTTTTAT KY079336.1 GGTATTATAGGTCATATATGTTTAAGATTGAGTTTAATTCCTGATGCTTTTGGGTTTTAT MW454849.1 GGTATTATAGGTCATATATGTATAAGATTGAGTTTAATTCCTGATGCTTTTGGGTTTTAT HM447234.1 GGTATTATAGGTCATATATGTTTAAGATTGAGTTTAATTCCTGATGCTTTTGGGTTTTAT GU433104.1 GGTATTATAGGTCATATATGTTTAAGATTGAGTTTGATTCCTGATGCTTTTGGGTTTTAT MW454842.1 GGTATTATAGGTCATAAATGTTTAAGATTGAGTTTGATTCCTGATGCTTTTGGGTTTTAT
**************** * * ************* ************************
AP017666.1 GGTTTATTATTTGCTATGTTTTCTATAGTGTGCTTAGGTTGTAGTGTGTGGGCTCATCAT MW454850.1 GGTTTATTATTTGCTATGTTTTCTATAGTGTGCTTAGGTTGTAGTGTGTGGGCTCATCAT MW454846.1 GGTTTATTATTTGCTATGTTTTCTATAGTGTGCTTAGGTTGTAGTGTGTGGGCTCATCAT MW454843.1 GGTTTATTATTTGCTATGTTTTCTATAGTGTGCTTAGGTTGTAGTGTGTGGGCTCATCAT MW454847.1 GGTTTATTATTTGCTATGTTTTCTATAGTGTGCTTAGGTTGTAGTGTGTGGGCTCATCAT KY079336.1 GGTTTATTATTTGCTATGTTTTCTATAGTGTGCTTAGGTTGTAGTGTGTGGGCTCATCAT MW454849.1 GGTTTATTATTTGCTATGTTTTCTATAGTGTGCTTAGGTTGTAGTGTGTGGGCTCATCAT HM447234.1 GGTTTATTATTTGCTATGTTTTCTATAGTGTCGTTAGGTTGTAGTGTGTGGGCTCATCAT GU433104.1 GGTTTATTATTTGCTATGTTTTCTATAGTGTGCTTAGGTTGTAGTGTGTGGGCTCATCAT MW454842.1 GGTTTATTATTTGCTATGTTTTCTATAGTGTGCTTAGGTTGTAGTGTGTGGGCTCATCAT
******************************* ***************************
AP017666.1 ATGTTTACTGTTGGTTTGGATGTTAAGACGGCTGTATTTTTTAGGTCTGTGACTATGATT MW454850.1 ATGTTTACTGTTGGTTTGGATGTTAAGACGGCTGTATTTTTTAGGTCTGTGACTATGATT MW454846.1 ATGTTTACTGTTGGTTTGGATGTTAAGACGGCTGTATTTTTTAGGTCTGTGACTATGATT MW454843.1 ATGTTTACTGTTGGTTTGGATGTTAAGACGGCTGTATTTTTTAGGTCTGTGACTATGATT MW454847.1 ATGTTTACTGTTGGTTTGGATGTTAAGACGGCTGTATTTTTTAGGTCTGTGACTATGATT KY079336.1 ATGTTTACTGTTGGTTTGGATGTTAAGACGGCTGTATTTTTTAGGTCTGTGACTATGATT MW454849.1 ATGTTTACTGTTGGTTTGGATGTTAAGACGGCTGTATTTTTTAGGTCTGTGACTATGATT
HM447234.1 ATGTTTACTGTTGGTTTGGATGTTAAGACGGCTGTATTTTTTAGGTCTGTGACTATGATT GU433104.1 ATGTTTACTGTTGGTTTGGATGTTAAGACAGCTGTATTTTTTAGGTCTGTGACTATGATT MW454842.1 ATGTTTACTGTTGGTTTGGATGTTAAGACAGCTGTATTTTTTAGGTCTGTGACTATGATT
***************************** ******************************
AP017666.1 ATAGGAATACCTACTGGTATTAAGGTATTTACGTGGTTATATATGCTTTTAAACTCTATG MW454850.1 ATAGGAATACCTACTGGTATTAAGGTATTTACGTGGTTATATATGCTTTTAAACTCTATG MW454846.1 ATAGGAATACCTACTGGTATTAAGGTATTTACGTGGTTATATATGCTTTTAAACTCTATG MW454843.1 ATAGGAATACCTACTGGTATTAAGGTATTTACGTGGTTATATATGCTTTTAAACTCTATG MW454847.1 ATAGGAATACCTACTGGTATTAAGGTATTTACGTGGTTATATATGCTTTTAAACTCTATG KY079336.1 ATAGGAATACCTACTGGTATTAAGGTATTTACGTGGTTATATATGCTTTTAAACTCTATG MW454849.1 ATAGGAATACCTACTGGTATTAAGGTATTTACGTGGTTATATATGCTTTTAAACTCTATG HM447234.1 ATAGGAATACCTACGGGTATTAAGGTATTTACGTGGTTATATATGCTTTTAAATTCTATG GU433104.1 ATAGGAATACCTACTGGTATTAAGGTATTTACGTGGTTATATATGCTTTTAAATTCTATG MW454842.1 ATAGGAATACCTACTGGTATTAAGGTATTTACGTGGTTATATATGCTTTTAAATTCTATG
************** ************************************** ******
AP017666.1 GCTAAAAAGAGTGATCCGGTGATATGGTGAATAGTATCATTTATTGTGTTGTTTAGATTT MW454850.1 GCTAAAAAGAGTGATCCGGTGATATGGTGAATAGTATCATTTATTGTGTTGTTTAGATTT MW454846.1 GCTAAAAAGAGTGATCCGGTGATATGGTGAATAGTATCATTTATTGTGTTGTTTAGATTT MW454843.1 GCTAAAAAGAGTGATCCGGTGATATGGTGAATAGTATCATTTATTGTGTTGTTTAGATTT MW454847.1 GCTAAAAAGAGTGATCCGGTGATATGGTGAATAGTATCATTTATTGTGTTGTTTAGATTT KY079336.1 GCTAAAAAGAGTGATCCGGTGATATGGTGAATAGTATCATTTATTGTGTTGTTCAGATTT MW454849.1 GCTAAAAAGAGTGATCCGGTGATATGGTGAATAGTATCATTTATTGTGTTGTTTAGATTT HM447234.1 GCTAAAAAGAGTGATCCGGTGATATGGTGAATAGTATCATTTATTGTGTTGTTTAGATTT GU433104.1 GCTAAAAAGAGTGATCCGGTAATATGGTGAATAGTATCATTTATTGTGTTGTTTAGATTT MW454842.1 GCTAAAAAGAGTGATCCGGTAATATGGTGAATAGTATCATTTATTGTGTTGTTTAGATTT
******************** ******************************** ******
AP017666.1 GGTGGTGTGACTGGTATTATTTTGTCAGCTTGTGTTTTGGATAAAGTTTTACATGATACT MW454850.1 GGTGGTGTGACTGGTATTATTTTGTCAGCTTGTGTTTTGGATAAAGTTTTACATGATACT MW454846.1 GGTGGTGTGACTGGTATTATTTTGTCAGCTTGTGTTTTGGATAAAGTTTTACATGATACT MW454843.1 GGTGGTGTGACTGGTATTATTTTGTCAGCTTGTGTTTTGGATAAAGTTTTACATGATACT MW454847.1 GGTGGTGTGACTGGTATTATTTTGTCAGCTTGTGTTTTGGATAAAGTTTTACATGATACT KY079336.1 GGTGGTGTGACCGGTATTATTTTATCAGCTTGTGTTTTGGATAAAGTTTTACATGATACT MW454849.1 GGTGGTGTGACTGGTATTATTTTATCAGCTTGTGTTTTGGATAAAGTTTTACATGATACT
HM447234.1 GGTGGTGTGACTGGTATTATTTTATCAGCTTGTGTTTTGGATAAAGTTTTACATGATACT GU433104.1 GGTGGTGTGACTGGTATTATTTTATCAGCTTGTGTTTTGGATAAAGTTTTACATGATACT MW454842.1 GGTGGTGTGACTGGTATTATTTTATCAGCTTGTGTTTTGGATAAAGTTTTACATGATACT
*********** *********** ************************************
Figure (10): Multiple sequence alignment analysis of cytochrome c oxidase subunit 1 (cox1) gene in local Rat Hymenolepis nana isolates and NCBI-Genbank Hymenolepis nana country related isolates. The multiple alignment analysis was constructed using (ClustalW alignment tool. Online). That alignment analysis was showed the nucleotide alignment similarity as (*) and substitution mutations in cytochrome c oxidase subunit 1
(cox1) gene between isolates.
Figure (11): Phylogenetic tree analysis based cytochrome c oxidase subunit 1 (cox1) gene partial sequence in local Rat Hymenolepis nana isolates that used for genetic relationship analysis. The phylogenetic tree was constructed using Unweighted Pair Group method with Arithmetic Mean (UPGMA tree) in (MEGA 6.0 version). The local Hymenolepis nana isolates
(No.1) were showed closed related to NCBI-BLAST Hymenolepis nana Egypt isolate. The Hymenolepis nana the local Hymenolepis nana isolates (No.1, No.5, No.6, and No.9) showed
closed related to NCBI-BLAST Hymenolepis nana Japan isolate. Whereas, the local Hymenolepis nana isolates (No.8) showed new variant isolate at total genetic changes (0.025-
0.0050%).
Discussion
The results showed that the range measurement of length and width agreement with other measurement reported by some researchers Rawat et al. (2020) who mention that eggs specific to H. diminuta. it was yellowish-brown in colour and round to oval shaped and measured about 70-80
(length)×60-70 µm(width) and having hexacanth embryo with three pairs of hooks and the absence of polar filaments. Also Panti-Maya et al. (2020) who recorded that the egg of H. nana was 44–54 (length)×38–44(width)μm with polar filaments. While disagreement with Ash et al. (1994) and Pérez-Chacón et al. (2017) recorded that the measurement of H. nana eggs was 30–47μm in diameter, and contain an oncosphere with six hooks surrounded by an inner membrane with polar thickenings from which four to eight polar filaments arise and extend to the space between the oncosphere and the outer shell whereas H. diminuta their eggs are yellowish and larger. They measure 60–80 μm in diameter and the oncosphere is separated from the outer membrane by a clear space without polar filaments.
The results of the present study of prevalence rats are in the ratio is close to with Fitte et al., (2017) who stated of total Hymenolepiasis prevalence at 20.4%. While the results are in disagreement with other scientific studies by Guddissa et al. (2011) who reported that the prevalence rat was 33.93 % in Ethiopian and Karim and Al-Salihi (2014) who recorded 3/4 (75%) rats with infected rats revealed 5- 8 adult worm that were attached on the intestinal wall in Iraq.
The present study showed relatively higher prevalence of H. diminuta (18%) followed by H.
nana (7%). This result is in agreement with those observed by Guddissa et al. (2011) where the author reported the high prevalence of H. diminuta (26.79 %) followed by H. nana (7.1 %) in rats at Ethiopian. Further, Singh et al., (2020) who recorded that higher prevalence of H. diminuta (35%) followed by H. nana (23.3%). On the other hand, this result is in disagreement with Tijjania et al.
(2020) who referred that the H. nana (19.1%) was higher than H. diminuta (16.8%) Also Tung et al.
(2013) who found that H. nana was 21.8% whereas H. diminuta was 6.3% in the Taiwan.
The results of the present study revealed the differences in percentage of positive samples according to the sex. This result is in agreement with those observed by Ahmed et al.(2014) who stated the prevalence in male were much higher than female 43.8% and 29.3% respectively. Panti- May et al. (2017) who referred that the prevalence rates of male were higher than female 15.2% and 12.8%, respectively. On the other hand, this result is in disagreement with Mazhari et al. (2019) who referred that the prevalence rates of male were higher than female 58.3% and 41.7%
respectively.
The highest percentage in male in comparison with female to be referable to travel of male from one population to the other getting more chance to contact infection from infected intermediate hosts (Ahmad et al., 2014).Our results are agreed with Ahmed et al. (2014) who found that the highest (48.0%) month-wise prevalence of H. diminuta during August whereas the lowest (28.0%) during January and the highest seasonal prevalence peak (45.4%) was during summer followed by spring (35.1%), autumn (31.9%) and the lowest (29.3%) in rats / mice captured during winter.
Isolates of H. nana and H. diminuta infecting rodents are morphologically identical; the only way they can be reliably distinguished is by comparing the parasite in each host using molecular techniques (Cheng et al., 2016). Genetic diversity of H. nana and H. diminuta has been studied using some genetic makers, such as cytochrome c oxidase subunit 1 (cox1) and the first and second internal transcribed spacer (18S rRNA-ITS1) regions of nuclear ribosomal DNA (rDNA) (Okamoto et al., 1997 and Macnish et al., 2002). In present study, genomic DNA was extracted from 100 rat specimens, from different geographical locations in Baghdad/Iraq. It was used three primers Hymenolepis sp Mitochondrial cox1 gene, H. nana 18S rRNA-ITS1 gene and H. diminuta 18S rRNA-ITS1 gene but the lengths of the amplified fragment were different for H. nana and H.
diminuta, PCR amplification of (cox1) gene in Hymenolepis sp. at 700bp, PCR H. nana at 535bp
and H. diminuta at 361bp duplex PCR product size. Using this technique aims at asserting the diagnosis of the sample already registered in the current study then being compared with the global sample in order to get knowledge on the nitrogen bases of cox1 gene and 18S rRNA-ITS1 gene in H. nana and H. diminuta from Rat stool samples; as this technique is regarded as one of the most precise methods of diagnosis, and that can be useful in the genetic and biological studies in comparison with the previous local or global studies (Shubber et al., 2019).
By the analysis of the phylogenetic tree; convergence of nitrogen bases for the two types of cestoda (H.nana & H.diminuta) with those samples globally registered has been noticed: the samples of the H. diminuta in the current study is asymptotic to that having the Serial No.
MK614218.1 registered in Iran by (Makki et al., 2017), the Serial No. MN536015.1 registered in Mexico by (Panti-Maya et al., 2020), the Serial No. KY079338.1 registered in China by (Yang et al., 2017) and the Serial No. AF096244.2 registered in Korea by (LEE et al., 2007).
Besides, it has been noticed that the sample of H. nana in the current study are approaching that one having the serial No. GU433103.1 registered in Egypt by (Kandil et al., 2010), the serial No. AP017666.1 registered in Japan by (Cheng et al., 2015), the serial No. KY079336.1 registered in China by (Yang et al., 2017) and the serial No. HM447234.1 registered in Mexico by (Panti-May et al., 2020).
In conclusion, two species of Hymenolepis were identified in Baghdad/Iraq H. nana and H.
diminuta from Rats. The morphological and phylogenetic analysis allowed us the correct identification of the Hymenolepis spp. The occurrence of these Hymenolepis cestodes in Baghdad to monitor rodent populations and potential intermediate hosts to identify sources of Hymenolepiasis of poor communities and avoid transmission of Hymenolepis spp. to human
Reference
1. Ahmad, M. S.; A. Maqbool, A. A. Anjum, N. Ahmad, M. R Khan, R. Sultana and M. A. Ali (2014). Occurrence of hymenolepis diminuta in rats and mice captured from urban localities of Lahore, Pakistan. The Journal of Animal & Plant Sciences, 24(2): Page: 392-396. ISSN:
1018-7081.
2. Al- Zubaidei H. H. and Kawan M. H. (2020). Prevalence of Cryptosporidiosis in Ostriches from Central and South Parts of Iraq. The Iraqi Journal of Veterinary Medicine, 44 (1): 63- 67.
3. Ash LR, Orihel TC, Salvioli L, 1994. Bench Aids for the Diagnosis of Intestinal Parasites.
Geneva, Switzerland: World Health Organization.
4. Cheng T, Gao DZ, Zhu WN, Fang SF, Chen N, Zhu XQ, Liu GH, Lin RQ. Genetic variability among Hymenolepis nana isolates from different geographical regions in China revealed by sequence analysis of three mitochondrial genes. Mitochondrial DNA Part A.
2016; 27(6): 4646-50.
5. Cheng, T., Liu, G.-H., Song, H.-Q., Lin, R.-Q., & Zhu, X.-Q. (2015).The complete mitochondrial genome of the dwarf tapeworm Hymenolepis nana—a neglected zoonotic helminth. Parasitology Research, 115(3), 1253–1262. doi:10.1007/s00436-015-4862-8.
6. Fitte, B. ;Robles, M. R. ; Dellarupe, A.; Unzaga, J.M. and Navone, G.T. (2017).
Hymenolepis diminuta and Rodentolepis nana (Hymenolepididae: Cyclophyllidea) in urban rodents of Gran La Plata: association with socio-environmental conditions. Journal of
Helminthology, PP: 1-5
https://www.cambridge.org/core.DOI:10.1017/S0022149X17000864.
https://doi.org/10.1017/S0022149X17000864.
7. Franssen F, Swart A, van Knapen F, van der Giessen J. Helminth parasites in black rats (Rattus rattus) and brown rats (Rattus norvegicus) from different environments in the Netherlands. Infect Ecol Epidemiol 2016; 6: 31413.
8. Goswami, R.; Kataria, M. and Somvanshi, R. (2011). Clinicopathological studies on spontaneous Hymenolepis diminuta infection in wild and laboratory rats. Brazilian Journal of Veterinary Pathology 4(2):103-111.
9. Guddissa T, Mazengia H, Alemo S, Nigussie M (2011) Prevalence of gastrointestinal parasites of laboratory animals at Ethiopian Health and Nutrition Research Institute (EHNRI). Addis Ababa. J Infect Dis Immunol 3(1):1–5.
10. Kandil OM, Mahmoud MS, Allam NAT, El Namaky AH (2010). Mitochondrial cytochrome C oxidase subunit 1 (cox 1) gene sequence of the Hymenolepis species. J Am Sci 6:640–
647. https://doi.org/10.7537/marsjas061210.72
11. Karim, A. J and Al-Salihi K A (2014). Diagnostic Study on accidental Hymenolepis diminuta Infection in Laboratory Rats in Iraq. Mirror of Research in Veterinary Sciences
and Animals (MRVSA). 3(3), 33-40.
http://mirrorofresearchinveterinarysciencesandanimals.com/ ISSN 2307-8073.
12. LEE, S.; CHUN, H. and HUH, S. (2007). Molecular phylogeny of parasitic Platyhelminthes based on sequences of partial 28S rDNA D1 and mitochondrial cytochrome c oxidase subunit I. Korean Journal of Parasitology, Korean Journal of Parasitology Vol. 45, No. 3:
181-189 DOI: 10.3347/kjp.2007.45.3.181.
13. Macnish, M.G. ; U.M. Morgan-Ryan, P.T. Monis, J.M. Behnke, R.C.A. Thompson, A molecular phylogeny of nuclear and mitochondrial sequences in Hymenolepis nana (Cestoda) supports the existence of a cryptic species, Parasitology 125 (2002) 567–575, https://doi.org/10.1017/S0031182002002366.
14. Majeed, Sh. A. (2016). Prevalence of intestinal parasites in Rattus rattus in some districts in Baghdad/ Iraq. Al-Anbar J. Vet. Sci., Vol.: 9 No. (1). PP: 43- 48. ISSN: 1999-6527.
15. Makki, M. S.; Mowlavi, G; Shahbazi, F.; Abai, M.R.; Najafi, F.; Hosseini-Farash, B. R. ; Teimoori, S.; Hamid Hasanpour, H. and Saied Reza Naddaf, S. R. (2017). Identification of HymenolepisdiminutaCysticercoid Larvae in Tribolium castaneum (Coleoptera:
Tenebrionidae) Beetles from Iran. J Arthropod-Borne Dis, June 2017, 11(2): 338–343.
http://jad.tums.ac.ir.
16. Mazhari, N.; Parisa Moosavi, Ehsan Mostafavi, Behzad Esfandiari3 , Iraj Mobedi; Bahman Rahimi Esboei1 , Gholamreza Mowlavi. (2019). Intestinal Parasitic Helminths of Rattus spp. in Caspian Sea Littoral, Iran. J Med Microbiol Infect Dis, 2019, 7 (1-2): 32-36. DOI:
10.29252/JoMMID.7.1.2.32. http://jommid.pasteur.ac.ir.
17. Metwally, D. M.; Al-Enezy, H.A.; Al-Turaiki, I.M.; El-Khadragy, M. F.; Hany, M. Y. and Al-Otaibi, T.T. (2019). Gene-based molecular characterization of cox1 and pnad5 in Hymenolepis nana isolated from naturally infected mice and rats in Saudi Arabia.
Bioscience Report. 39.
18. Nkouawa, A.; Haukisalmi V.; Li, T.; Nakao, M.; Lavikainen, A.; Chen, X.; Henttonen H.
and Ito A. (2016). Cryptic diversity in hymenolepidid tapeworms infecting humans.
Parasitol. Int., 65: 83-86. https://doi.org/10.1016/j.parint.2015.10.009.
19. Okamoto M, Agatsuma T, Kurosawa T, Ito A. Phylogenetic relationships of three
hymenolepidid species inferred from nuclear ribosomal and mitochondrial DNA sequences.
Parasitology. 1997; 115(6): 661-6.
20. Palmer SR, Soulsby L and Torgerson P, 2011. Oxford textbook of zoonoses. Biology, clinical practice, and public health control. 2nd edn. Oxford University Press. New york.
sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673–4680, https://doi.org/10.1093/nar/22.22.4673
21. Panti-May, J.A. ; R.R.C. Andrade, Y. Gurubel-González, E. Palomo-Arjona, L.
SodáTamayo, J. Meza-Sulú, M. Ramírez-Sierra, E. Dumonteil, V.M. Vidal-Martínez, C.
Machain-Williams, D. Oliveira, M.G. Reis, M.A. Torres-Castro, M.R. Robles, S.F.
Hernández-Betancourt, F. Costa, A survey of zoonotic pathogens carried by house mouse and black rat populations in Yucatan, Mexico, Epidemiol. Infect. 145 (2017) 2287–2295, https://doi.org/10.1017/S0950268817001352.
22. Panti-Maya, J. A.; Andrea Servíanb, Walter Ferrarib, María Lorena Zontab, David I.
Hernández-Menac, Silvia F. Hernández-Betancourta, María del Rosario Roblesb, Carlos Machain-Williamsd (2020). Morphological and molecular identification of hymenolepidid cestodes in children and synanthropic rodents from rural Mexico. Parasitology International 75, 102042, PP; 1-7. journal homepage: www.elsevier.com/locate/parint
23. Panti-Maya, J.A.; Andrea Servíanb , Walter Ferrarib , María Lorena Zontab , David I.
Hernández-Menac , Silvia F. Hernández-Betancourta , María del Rosario Roblesb , Carlos Machain-Williams (2020). Morphological and molecular identification of hymenolepidid cestodes in children and synanthropic rodents from rural Mexico. Parasitology International 75 (2020) 102042; pp: 1-7. https://doi.org/10.1016/j.parint. Journal homepage:
www.elsevier.com/locate/parint.
24. Pérez-Chacón, G. ; Pocaterra, L. A.; Rojas, A.; Hernán, A.; Jiménez, J. C.; and Núñez, L.
(2017). Case Report: Coinfection with Hymenolepis nana, Hymenolepis diminuta, Giardia intestinalis, and Human Immunodeficiency Virus: A Case Report with Complex Immunologic Interactions. The American Society of Tropical Medicine and Hygiene, 96(5), 2017, pp. 1094–1096 doi:10.4269/ajtmh.16-0413.
25. Rawat, N. ;Dhananjay Kumar Jolhe2, Sadanand Devidas Hirpurkar1, Savita Bisen3, Shailesh Kumar Patel2, Chandrahas Sannat1 and Seema Mandavi (2020). Investigation and Therapeutic Management of Hymenolepiosis in Wistar Rats from Chhattisgarh. Journal of Animal Research: v.10 n.4 pp: 609-614 .
26. SAS. (2012). Statistical Analysis System, User's Guide. Statistical. Version 9.1th ed. SAS.
Inst. Inc. Cary. N.C. USA.
27. Shahnazi, M.; Majid, Z. M.; Safar, A. A.; Peyman, H.; Mehrzad, S. Mahmood, A. and Elham, H.(2019). Molecular characterization of Hymenolepis nana based on nuclear rDNA ITS2 gene marker. Afri. Hlth. Sci., 19(1): 1346- 1352.
28. Sharma S, Lyngdoh D, Roy B, Tandon V. (2016). Differential diagnosis and molecular characterization of Hymenolepis nana and Hymenolepis diminuta (Cestoda: Cyclophyllidea:
Hymenolepididae) based on nuclear rDNA ITS2 gene marker. Parasitol Res; 115: 4293- 4298.
29. Shubber, H. w. k.; Murtadha Nabeel and Murtadha Al-Tameemi (2019). Comparative Study morphological and Molecular for infected Rodent with two cestoda Hymenolepis nana & H.
diminuta In Al-Diwaniyah City, South Of Iraq. Journal of Physics: Conf. Series 1294, 062058. PP; 1-8. doi:10.1088/1742-6596/1294/6/062058.
30. Simões RO, Luque JL, Gentile R, Rosa MC, Costa-Neto S, Mal¬donado A. Biotic and abiotic effects on the intestinal helminth community of the brown rat Rattus norvegicus from Rio de Janei¬ro, Brazil. J Helminthol 2016; 90: 21-27.
31. Singh, R. P. ; Babul Chandra Roy1 , Asish Kumer Debnath1,2, Sultana Fizun Nahar1,3 and Md Hasanuzzaman Talukder1. (2020). Hymenolepiasis in rats (Rattus norvegicus) with its zoonotic potential in mymensingh district of Bangladesh. Res. Agric. Livest. Fish. Vol. 7(2):
255-259.
32. SoaresMagalhães JR, Fançony C, GamboaD, Langa AJ, Sousa-Figueiredo JC, Clements ACA & Vaz Nery S (2013). Extanding helminths control beyond STH and schistosomiaisis:
The case of human hymenolepiasis. PLoS Negl Trop Dis 7, e2321.
https://doi.org/10.1371/journal.pntd.0002321
33. Sood S, Yadav A, Katoch R, Ganai A, (2018). Hymenolepis nana infection in laboratory rats : A case report. Journal of Entomology and Zoology Studies, 6(4): 1202-1204.
34. Steinmann P, Cringoli G, Bruschi F, Matthys B, Lohourignon LK, Castagna B, Maurelli MP, Morgoglione ME, Utzinger J & Rinaldi L (2012). FLOTAC for the diagnosis of Hymenolepis spp. infection: Proof-of-concept and comparing diagnostic accuracy with other methods. Parasitol Res 111, 749–754. https://doi.org/10.1007/s00436-012-2895-9.
35. Struck, M. B.; Andrutis, K. A.; Ramirez, H. E. & Battles, A. H. (2011). Effect of a short- term fast on Ketamine-Xylazine Anesthesia in Rats. J. Am. Assoc. Lab. Anim. Sci., 50(3):
344-348.
36. Thompson, J.D., Higgins, D.G. and Gibson, T.J. (1994) CLUSTALW: improving the sensitivity of progressive multiple sequence alignment through
37. Thompson, R.A. (2015) Neglected zoonotic helminths: Hymenolepis nana, Echinococcus canadensis and Ancylostoma ceylanicum. Clin. Microbiol. Infect. 21, 426–432, https://doi.org/10.1016/j.cmi.2015.01.004.
38. Yang, D.I.; Zhao, W.; Zhang, Y. and Liu, A. (2017). Prevalence of Hymenolepis nana and H. diminuta from Brown Rats (Rattus norvegicus) in Heilongjiang Province, China.
Department of Parasitology; Harbin Medical University, Harbin, Heilongjiang 150081, China. Kor.J. Parasitol., 55 (3): 351-355.
