IL-6 Predict Disease Severity and Potential Therapeutic Target in COVID-19 Patient.
Ibrahim A. Altamemi 1, Ali Hussein Khlebos 2
1 Department of Microbiology, College of Medicine, University of Al-Qadisiyah, Iraq.
2 (Ph.D in Medical Microbiology).Iraqi Ministry Health, Al-Diwaniyah teaching hospital, Laboratory Department, Diwaniyah, Iraq.
ABSTRACT
Background:Abnormal immunological features were well-known in patients with COVID-19 is higher serum concentrations of inflammatory mediators. In deceased patients, serum level of interleukin 2, IL-6, IL-8, and TNF a show significant higher concentration than in improved patients. specifying the need for IL-6 detection for initial expectation of severity. Therapeutic management aimed at correcting excessive and aberrant host immune responses are postulated to be successful.
Thus, the aim of present works is to find out the distribution of IL-6 serum concentration among mild, and sever cases of patients with COVID-19 infection in Iraqi populations, and to find out whether SNP of IL-6 rs1800795 174 (C/G) genotype could effect on disease severity.
Patients and Methods: The case control study was established on the basis of three groups. 1st group was include 15 healthy volunteers which considered as a control groups, 2nd group include 20 mild cases of patients with SARS-CoV-2 infection, and 3rd group include 20 sever ill patients with SARS-CoV-2 infection, 5 ml of Blood samples were collected by venipuncture from 40 patients and 15 healthy controls, by disposable syringe under aseptic technique, about 2 ml of venous blood were drawn by in ethylinditetracitic acid (EDTA) tube and stored at 4℃ for DNA extraction for detection of IL-6 gene polymorphism by ARMS-PCR. And Three milliliters of blood were put in gel tube and allowed to clot then the serum was separated by centrifugation 1500 rpm for 5 minute. Then serum has been separated in Eppendorf tube for IL6 detection by ELISA test.
Results: Present study demonstrated that, IL-6 CC genotype was more frequent in severely ill patients with COVID-19 group than in healthy control group, in a significant manner (p = 0.014). Therefore, C/C genotype can be regarded as a risk factor. Regarding allele analysis, allele C was more frequent in severe group than in healthy control group, in a significant manner (p = 0.018). Therefore, C allele can be regarded as a risk factor.
Conclusions: In conclusion, We identified a strong correlation between the case severity of COVID-19 and frequency C/C genotype of the rs1800795174 SNP gene, in addition present data recommended to consider IL6 cytokines as akey factor to realize the therapy response in COVID-19 infected peoples.
KEYWORDS: IL-6; Disease severity; potential therapeutic; COVID-19 Patient.
1. INTRODUCTION
The outbreak of extreme acute respiratory infection with coronavirus-2 (SARS-CoV-2) continues to show new globally confirmed cases on a regular basis[1]. According to the WHO study, about 14% of patients established serious diseases needful oxygen treatment and 6% go throughunfavorably ill patients necessitating intensive care unit[2]. Thoseseverely ill patients have a bad prognosis, with a rise in death rate [3].No particular anti-viral approach has proved effective to date, and the strength of clinical administration is mainly depending of management of symptoms to a large extend. Early identification and care of serious and critically ill patients are key concerns that require urgent screening. Abnormal immunological features were well- knownin patients with COVID-19 is higher serum concentrations of inflammatory mediators, according to the clinical characteristics [4]. In deceased patients, serum level of interleukin 2, interleukin 6 (IL-6), interleukin 8 (IL-8), interleukin 10 (IL-10), and tumor necrosis factor a (TNF a) show significant higher concentration than in improved patients[5]. Moreover, the levels of these inflammatory mediators in thrilling cases were significantly higher than in mild cases[6], specifying the need for IL-6 detection for initial expectation of disease severity [7].Therapeutic management aimed at correcting unnecessary and unusual host immune reactions are postulated to be successful [8]. tocilizumab, considered a possible therapeutic alternative which is a monoclonal antibody directed against IL-6 receptor [9].
The aim of the currentwork is to find out the serum concentrations of IL-6 among mild, and sever cases of patients with COVID-19 infection in Iraq, and to find out whether SNP of IL- 6 rs1800795 174 (C/G) genotype couldeffect on disease severity and whether have a prognostic value. INTRO-3.
2.MATERIALS AND METHODS
2.1 Patient Group and Sample Collection
The case control study was established on the basis of three groups. 1st group was include15 healthy volunteers which considered as a control groups, 2nd group include 20mild cases of patients with SARS-CoV-2 infection, and 3rd group include 20 sever ill patients with SARS-CoV-2 infection,patients were hospitalized at Alshifaa Hospital, the nominated transitory hospitals for COVID-19. The diagnostic requirements for COVID-19 have been adopted by the National Health Commission's Interim or 7th Edition Guidelines, which include, history, clinical symptoms, Chest CT examination, and SARS-CoV-2 RNAdiscovery results were primarily included as a diagnostic criteria [10].
5 ml of Blood samples were collected by venipuncture from 40 patients and 15 healthy controls, blood samples were collected by disposable syringe under aseptic technique, about 2 ml of venous blood were drawn by in ethylinditetracitic acid (EDTA) tube and stored at 4℃ for DNA extraction for detection of IL-6 gene polymorphism. Three milliliters of blood were put in gel tube and allowed to clot then the serum was separated by centrifugation 1500 rpm for 5 minute. Then serum has been separated in Eppendorf tube for IL6 detection by ELISA test by using monoclonal anti IL6 Ab ELISA kit, supplied from ELAB.Bioscince (Korea) and procedure done according to manufactural instruction. Optical density, Which is measured spectrophotometrically at a wave length of 450nm, OD value is proportional to the concentration of IL-6 and then calculate the concentration of IL-6 in the sample by comparing the OD of the samples to the standard curve.
2.2.Genomic DNA Extraction
Geneaid’s (Frozen Blood) Genomic DNA miniextraction kit (USA) was used to extract the genomic DNA from samples of blood conferring to the instructionof company. Moreover, the Nano-drop spectrophotometer (THERMO, USA) was utilized to check purity, and concentration of extracted genomic blood DNAthrough absorbance reading at 260/280nm and calculated the concentration of DNA in (ng/μL). The genotypes of the IL-6 (rs1800795174) gene were determined by ARMS-PCR.
2.3.ARMS-PCR Primers
ARMS-PCR Primers for detection of IL-6 gene polymorphism rs1800795174 (C/G) were designed in this study by using (Web-Based Allele-specific primersof SNPs- Genome Institute, National Center for Genetic Engineering and Biotechnology (BIOTEC) (PathumThani, Thailand). Likewise, the primers weredelivered from Macrogen Company, Korea as below:
Wild type Forward Primer 5': CCCTAGTTGTGTCTTGTC Mutant Forward Primer 5': CCCTAGTTGTGTCTTGTG
Common Reverse Primer 5': ACTTGTGGAGAAGGAGTTCA 7 2.4.Statistical analysis
Data were collected, summarized, analyzed and presented using statistical package for social sciences (SPSS) software (IBM, Chicago, USA, version 16) and Microsoft office Excel 2007. Quantitative variables were presented as mean, standard deviation and range whereas qualitative variables were expressed as number and percentage. Chi-square test and Yates correction for continuity were used to compare differences in frequencies of genotypes and alleles among groups. Kruskall Wallis test was used to compare mean rank of serum IL-6 levels among all groups or among all genotypes within a single group. Mann Whitney U test was used to compare mean rank of serum IL-6 levels between any two groups or between any two genotypes within a single group. The level of significance was considered at p ≤ 0.05 and the level of high significance was considered at p ≤ 0.01.
3. RESULTS
The Comparison of Interleukin -6 (IL-6) genotypes between patients with severe clinical presentation and healthy control group is shown in table 1. In the dominant model, CC genotype was more frequent in severe group than in healthy control group, 15 (75 %) versus 5 (33.3 %), respectively, in a significant manner (p = 0.014). Therefore, C/C genotype can be regarded as a risk factor with an odds ratio (OR) of 6.00 (95% confidence interval of 1.37 -26.24) and an etiologic fraction (EF) of 0.63.
Regarding allele analysis, allele C was more frequent in severe group than in healthy control group, 33 (82.5 %) versus 17 (56.7 %), respectively, in a significant manner (p = 0.018).
Therefore, C allele can be regarded as a risk factor with an odds ratio (OR) of 3.61 (95%
confidence interval of 1.21 -10.72) and an etiologic fraction (EF) of 0.48.
In addition to that, when Interleukin -6 (IL-6) genotypes between patients with mild clinical presentation and healthy control group is shown in table 2. none of genotypes showed significant difference in its frequency distribution between mild group and healthy control group
(p> 0.05). Moreover, none of genotypes showed significant difference in its frequency distribution between mild group and healthy control group (p> 0.05).
Table 1: Comparison of Interleukin -6 (IL-6) genotypes between patients with severe clinical presentation and healthy control group
Model
IL-6
rs1800795 174 (C/G)
Severe n = 20
Control
n = 15 p-value OR 95 %
CI EF PF
Dominance
CC 15 5 0.014 C
S 6.00 1.37 -
26.24 0.63 ---
C/G+GG 5 10 Reference
Alleles C 33 17 0.018 C
S 3.61 1.21 -
10.72 0.48 ---
G 7 13 Reference
n: number of cases; IL-6: interleukin-6; OR: odds ratio; CI: confidence interval; EF: etiologic fraction; PF: preventive fraction; Y: Yates correction for continuity; C: Chi-square test; S:
significant at p ≤ 0.05; NS: not significant at p > 0.05
Table 2: Comparison of Interleukin -6 (IL-6) genotypes between patients with mild clinical presentation and healthy control group
Model IL-6
rs1800795 174 (C/G)
Mild n = 20
Control
n = 15 p-value OR 95 % CI EF PF Dominance
CC 11 5 0.203 C
NS 2.44 0.61 -9.80 0.41 ---
C/G+GG 9 10 Reference
Alleles
C 27 17 0.353 C
NS 1.59 0.60 -4.23 0.23 ---
G 13 13 Reference
n: number of cases; IL-6: interleukin-6; OR: odds ratio; CI: confidence interval; EF: etiologic fraction; PF: preventive fraction; Y: Yates correction for continuity; C: Chi-square test; NS: not significant at p > 0.05
Table 3: Comparison of Interleukin -6 (IL-6) genotypes between patients with severe clinical presentation and patients with mild clinical presentation
Model IL6
rs1800795 174 (C/G)
Severe n = 20
Mild
n = 20 p-value OR 95 % CI EF PF Dominance
CC 15 11 0.185 C
NS 2.45 0.64 -9.39 0.34 ---
C/G+GG 5 9 Reference
Alleles C 33 27 0.121 C 2.27 0.79 -6.49 0.31 ---
NS
G 7 13 Reference
n: number of cases; IL-6: interleukin-6; OR: odds ratio; CI: confidence interval; EF: etiologic fraction; PF: preventive fraction; Y: Yates correction for continuity; C: Chi-square test; NS: not significant at p > 0.05
The serum interleukin -6 (IL-6) levels according to clinical severity of the disease is shown in figure 1. There was highly significant variation in the serum IL-6 level among severe group, mild group and healthy control group (p< 0.001), the level being highest in the severe group followed by mild group and finally by control group.
4. DISCUSSION
According to result of present study, IL-6, CC genotype was found to be more frequent in severe group than in healthy control group, 15 (75 %) versus 5 (33.3 %), respectively, in a significant manner (p = 0.014). Therefore, C/C genotype can be regarded as a risk factor for prediction development of SARS-CoV-2 infected patient in to sever grade with cytokine storm.
And such impact of SNP on disease severity also has been studded previously on other diseases, In the presentpresentation of Severe respiratory disorder coronavirus 2 infection, a few is decoded about IL-6 association and its SNP in relation to pathogenesis idiopathic pulmonary damage in SARSCoV- 2 infection, excluding its important role to recruit the cytokine (IL-6) storm. A meta-analysis study that was done previously to demonstrate the IL6 gene polymorphism with tendency as well as disease severity of pneumonia, proposed the carrier status of IL6 174 C allele with higher IL-6 production and pneumonia severity (11). Thus, it came in agreement with present work, since we found that severe ill patients with IL-6 CC genotype was found to have significant (p< 0.001) higher concentration of serum IL-6 as shown in figure 1.
Jin and Wang concise the worth of single nucleotide polymorphisms (SNPs) and its impactonimmune response, so-called “immunogenetic profiling” (12). Likewise, some lung disease like chronic obstructive pulmonary disease (COPD) and asthma, degree of such disease severity was differentially detectedthroughSNP analysis (13). IL6-174 C/C genotype also associated with respiratory syncytial virus (RSV) infection extent (14).
According toknownfunction of IL-6 as anessentialorganizer for the CD4 T cell destiny, IL6 SNPcouldexplain moreabout COVID-19 pandemic. Therefore, present studyproposedthat, IL6 SNPact as biomarker to disease severity or to distinguish the pathological changesresulting from COVID-19 viral infections, which comprisingliability of certainpopulationsto have asymptomatic infection or other having insusceptible to the virus as identified earlier in different infectious diseases (15, 16).
Results of IL-6 blood concentrationwas assessed and examined in allcases that was included in this study. It is progressivelydocumented that extreme, malfunctionedbody immune system may playvital role in the progress and upkeep of seriousstages of illness.
Manyresearchers had stated that elevated IL-6 and other inflammatory Mediatorsconcentrationsassociated with degree of disease illness [17, 18]. Though present data was in reliable with that of these researches.
Nevertheless, association does not assurancecausativeness. Extremelyhigher IL-6 levels (> 107 pg/ml), whichstrictlyaccompanying with noticeable SARS-CoV-2 critically ill patients [19]. Additionalmeta-analysis studythat was done by Muhammad et al. included nine researches (1426 cases), and it proven that increases inbloodconcentration of IL-6 was concomitantwith augmented risk of COVID-19 complications and bad prognosis [20]. Thus,Hypothetically, consuming IL-6 receptor blockers in initial stage of COVID-19 might be furtheruseful to counter the consequence. Since IL-6 consider as a pyrogenic proinflammatory cytokine. Thus,by using receptor Blockers, it is expectable that body temperature might decline, and respiratory distress might be relieved to some point.
Figure 1: The serum interleukin -6 (IL-6) levels according to clinical severity of the disease
CONCLUSION
In conclusion, this case control study was conducting regarding the between the case severity of COVID-19 and SNP of the IL6 genes in addition to serum level of IL-6in Iraqi population. IL6 genes. We identified a strong correlation between the case severity of COVID- 19 and frequency C/C genotype of the rs1800795174 SNP gene, in addition present data recommended to think throughproinflammatory IL6 cytokine as akeyplayer to comprehend the therapeutic response for COVID-19 viral infection, due to strong association between its serum concentration and disease severity.
Media n (IQR): 261.35 (155.37) Ra nge: 107.46 - 420.06
Media n (IQR): 195.06 (42.24) Ra nge: 81.23 - 201.67
Media n (IQR): 78.01 (52.45) Ra nge: 5.21 - 130.12
REFERENCES
1. World Health Organization. Coronavirus disease (COVID-2019) situation reports 2020.
https ://www.who.int/emerg encie s/disea ses/novel –corona viru s-2019/situa tion-repor ts/.
Accessed 26 Mar 2020.
2. Report of the WHO-China Joint Mission on Coronavirus Disease 2019 (COVID-19). https ://www.who.int/publi catio ns-detai l/repor t-of-the-whochina-joint -missi on-on-coron aviru s-disea se-2019-(covid -19)/. Accessed 2Apr 2020.
3. Shen C, et al. Treatment of 5 critically ill patients with COVID-19 with convalescent plasma. JAMA. 2020;323(16):1582–9.
4. Huang C, et al. Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. Lancet. 2020;395(10223):497–506.
5. Chen T, et al. Clinical characteristics of 113 deceased patients with coronavirus disease 2019: retrospective study. BMJ. 2020a;368:m1091.
6. Chen G, et al. Clinical and immunologic features in severe and moderate Coronavirus Disease 2019. J Clin Invest. 2020b;130(5):2620–9.
7. Gao Y, et al. Diagnostic utility of clinical laboratory data determinations for patients with the severe COVID-19. J Med Virol. 2020;92(7):791–6.
8. Zumla A, Hui DS, Azhar EI, Memish ZA, Maeurer M. Reducing mortality from 2019- nCoV: host-directed therapies should be an option. Lancet. 2020;395(10224):e35–6.
9. Xu XL, et al. Effective treatment of severe covid-19 patients with tocilizumab. https ://doi.org/10.12074 /20200 3.00026 . Posted on chinaXiv 5 Mar 2020. (preprint).
10. The guideline of diagnosis and treatment on novel coronavirus pneumonia. https ://www.nhc.gov.cn/yzygj /s7652 m/20200 3/a3119 1442e 29474 b98bf ed557 9d5af 95.shtml /. Accessed 3 Mar 2020.
11. Ulhaq, Z. S., & Soraya, G. V. J. A. a S. (2020). Anti-IL-6 receptor antibody treatment for severe COVID-19 and the potential implication of IL-6 gene polymorphisms in novel coronavirus pneumonia. (May 2, 2020). https://doi.org/10.2139/ssrn.3592878
12. Jin, P., & Wang, E. (2003). Polymorphism in clinical immunology – From HLA typing to immunogenetic profiling. Journal of Translational Medicine, 1(1), 8.
https://doi.org/10.1186/1479-5876-1-8
13. Kirtipal, N., Thakur, H., Sobti, R. C., & Janmeja, A. K. (2020). Association between IL6 gene polymorphism and the risk of chronic obstructive pulmonary disease in the north Indian population. Molecular Biology Research Communications, 9(2), 41–43.
14. Doyle, W. J., Casselbrant, M. L., Li-Korotky, H. S., Doyle, A. P., Lo, C. Y., Turner, R., &
Cohen, S. (2010). The interleukin 6 -174 C/C genotype predicts greater rhinovirus illness.
The Journal of Infectious Diseases, 201(2), 199–206. https://doi.org/10.1086/649559
15. Linnik, J. E., & Egli, A. (2016). Impact of host genetic polymorphisms on vaccine induced antibody response. Human Vaccines & Immunotherapeutics, 12(4), 907–915.
https://doi.org/10.1080/21645515. 2015.1119345.
16. Riazalhosseini, B., Mohamed, Z., Apalasamy, Y. D., Shafie, N. S., & Mohamed, R. (2018).
Interleukin-6 gene variants are associated with reduced risk of chronicity in hepatitis B virus infection in a Malaysian population. Biomedical Reports, 9(3), 213–220.
https://doi.org/10.3892/br.2018.1126
17. Tao L, et al. The potential role of IL-6 in monitoring severe case of coronavirus disease 2019. https ://doi.org/10.1101/2020.03.01.20029 769. Posted on medRxiv 10 Mar 2020.
(preprint)
18. Gong J, et al. Correlation analysis between disease severity and inflammation- related parameters in patients with COVID-19 pneumonia. https ://
doi.org/10.1101/2020.02.25.20025 643. Posted on medRxiv 27 Feb 2020.
19. Chen XH, et al. Detectable serum SARS-CoV-2 viral load (RNAaemia) is closely associated with drastically elevated interleukin 6 (IL-6) level in critically ill COVID-19 patients. https ://doi.org/10.1101/2020.02.29.20029 520. Posted on medRxiv 03 Mar 2020.
20. Aziz M, Fatima R, Assaly R. Elevated interleukin-6 and severe COVID-19: a meta-analysis.
J Med Virol. 2020. https ://doi.org/10.1002/jmv.25948.
