View of Role of OMP Expression in Carbapenem Resistance in Clinical Isolates of Klebsiella Pneumoniae

Role of OMP Expression in Carbapenem Resistance in Clinical Isolates of Klebsiella Pneumoniae

ReemHusam Tabra, Mohammed I.Nader Abstract

Klebsiella pneumoniae has been emerged as one of the most important causes of urinary tract infection UTI. The deficiency of porins ompK35 and ompK36 are important for the development of carbapenem-resistant K. pneumoniae. Clinical K. pneumoniae isolates has been characterized and investigated for the effect of meropenem on the ompK35 and ompK36 and their reduced expression to develop carbapenem resistance for six carbapenem resistant K.

pneumoniae strains. One hundred eighty urine specimens were collected from impatiens and outpatients admitted to three hospitals in Baghdad, cultured and examined microscopically and identified by traditional biochemical tests, VITEK-2 system and molecular identification using the specific gene tyrBK. pneumoniae by polymerase chain reaction. Forty four isolates were identified as K. pneumoniae (24.4%) of the total collected bacteria causing UTI. Theantibiotic susceptibility and Minimal inhibitory concentration (MIC) test of 44 K. pneumoniae isolates towards meropenem antibiotic was examined using disc diffusion method and E-test method respectively, results showed that 6 (13.6%) were resistant to meropenem with MIC value (4-8 μg/ml), 35 (79.5%) were sensitive with MIC value (0.125-0.5μg μg/ml), while 3(6.8%) isolates were of intermediate resistant with MIC of (2 μg/ml). Poringene expression ompK35 and ompK36 genes was conducted using real-time quantitative PCR assay. Gene expression fold were recorded for three study groups, antibiotic sensitive group as control group, antibiotic resistant group before treatment with meropenem and resistant group after treatment with meropenm with a concentration of (1μg/ml) for all resistant isolates. The highest value of gene expression fold in ompK35 gene was recorded for the sensitive group (1.00), andthe untreated meropenem group gene expression fold of ompK35 (0.95), while the lowest gene expression fold of ompK35 gene was for meropenem treated group (0.055).The highest value of gene expression fold in ompK36 gene was recorded for the untreated meropenem group (1.33), and the gene expression fold of sensitive group of ompK36 (1.00), while the lowest gene expression fold of ompK36 gene was for meropenem treated group (0.007)depending on 2^-Δct method. When depending on 2^-ΔΔct method, Gene expression fold had slight difference.

Introduction

Klebsiella pneumoniae is Gram-negative, encapsulated, rod-shaped non-motile, lactose- fermenting, gas-producing, facultative anaerobic bacterium. K. pneumoniae have the ability to grow with or without oxygen, esteem its facultative anaerobe (Jing et al., 2012).Klebsiella is an opportunistic pathogen and this is associated with its owing an antiphagocytosis capsule (Umhe et al., 2006).Klebsiella causes a range of Nosocomial infections such as urinary tract infection,

respiratory tract infection, surgical wounds,Osteoporosis, as well as it infects mucous membranes, necrosis, lung injury, and meningitis (Kumar and Talwar, 2010; Wiskur et al., 2008).K. pneumoniae strains are usually opportunistic pathogens involved in urinary tract infections and catheter-associated urinary-tract infections in hospitalized patients and compromised individuals. Some infections are from medical instrument like urinary catheters which considered the main location of K. pneumoniae. K. pneumoniae has been suggested to be involved in the formation of biofilms on these surfaces (Lavender et al., 2004).K. pneumoniae is one of MDR organisms that identified as an instant threat to human health by World Health Organization (WHO) (Kidd et al., 2017). K.pneumoniae has several mechanisms of antibiotic resistance, including 1 antibiotic inactivation/alteration 2 modification of antibiotic binding sites 3 efflux pump 4 biofilm formation and 5 changes in cell permeability resulting in reduced intracellular antibiotic accumulation .(Wilson, 2014; Wright, 2005). One of the major cause or the major contributing factor to antibiotic resistant phenotype in bacteria, especially Gram- negative species is the alteration in permeability of the outer membrane. In a number of Enterobacteriaceae members, including K. pneumonia, Escherichia coli and Salmonella spp., there are three major out membrane porins OMPs that were named in E. coli as OmpC, OmpA and OmpF. These porins permit the passage of nutrients and many other molecules in and out of the bacterial cell, including the passage of a variety of antibiotics. K. pneumoniae loss or reduced expression of the two major outer membrane porinsOmpK35 and OmpK36 confers resistance to carbapenem in strains producing extended spectrum β lactamases or plasmid-mediated AmpC- type β-lactamases. (Hashemi et al., 2014). OmpK35 has been reported to allow penetration of many β-lactam antibiotics including cefoxitin and cefotaxime and to a lesser extent meropenem and imipenem (Domenech-Sanchez et al., 1999). A study has reported that clinical exposure to cefuroxime can decrease the expression of OmpK35 (Kallman et al., 2008). Loss or reduced expression of OmpK36 has been related with resistance to β-lactams, including the carbapenems antibiotic. It has been shown that K. pneumoniae strains that exhibits resistance to carbapenems, OmpK36 is often lacked, suggesting that carbapenem antibiotics are capable of penetrating the cell through this porin (Kaczmarek et al., 2006).

Materials and methods

Isolation and identification ofK. pneumoniae

In this study the bacterial isolates were collected from three hospitals in Baghdad, Iraq, between September 2018 and December 2018. Out of 180 Urine sample, a total 44 isolates were identified as K.pneumoniae. The isolates were collected from impatients and outpatients suffering from UTI .MacConkey (Himedia) and blood agar (Himedia) were used for the isolation of K.pneumoniae.All of the isolates were identified by using the traditional biochemical tests, VITEK2 system (bioMerieux, France), according to the manufacturers recommendations.

Molecular identification of K.pneumoniae (DNA extraction and identification of K.

pneumoniae tyrB specific gene)

Identification was confirmed with molecular identification using K. pneumoniae tyrB specific gene. First DNA was extracted from all the K.pneumoniae isolates using genomic extraction Kit (Promega/ USA). Concentrations and purity of the extracted isolates was monitored by Nanodrope (Thermo Scientific/USA). Polymerase chain reaction was used to detect the K.pneumoniae tyrBgene. The primers (Alpha/Canada) used to amplify this gene was: F (5^-- GGCTGTACTACAACGATGAC-3^-

)

)

initial denaturation at 95 C˚ for 5 minutes, followed by 35 cycle of denaturation at 95 C˚for 1 minuet, annealing at 55 C˚ for 1 minuet, extension at 72 C˚ for 1 minuet, and a final extension step at 72 for 10 minutes. PCR products resulted from this run were run in 2% agarose gel within 1X TBE with 2µl of (20000X) red safe, electric field was applied at 5 volt for each cm of the gel for 120 min. DNA bands together with (100bp) ladder (Intron/Korea) were visualized using UV- Transiluminater and photographed.

Antibiotic susceptibility test

Antimicrobial susceptibility test was performed using Kirby-Bauer method for meropenem antibiotic. All isolates of K. pneumonae were grown on MacConkey agar overnight. One or two colonies of each isolate were resuspended in normal saline. The turbidity of the suspension is adjusted to 0.5 MacFarland, then the suspension was used to inoculate the preprepared Mueller- Hinton agar (Himedia). The antibiotic disc used in this study was meropenem (MEM) of (10µg).

This antimicrobial disc was placed on the medium. The plates were incubated at 37°C overnight .The inhibition zones diameter were measured and interpreted according to CLSI breakpoint interpretive criteria (CLSI, 2014) into susceptible, intermediate and resistant.

Determination of Minimum inhibitory concentration (MIC)

All the 44 K. pneumoniae isolates that were previously detected as resistant or sensitive to meropenem antibiotic were subjected to E-test (diagnostic liofilchem/Italy).K. pneumonae were grown on MacConkey agar overnight. Similar colonies of each isolate were resuspended in normal saline. The turbidity of the suspension is adjusted to 0.5 MacFarland, then the suspension was used to inoculate the preprepared Mueller- Hinton agar (Himedia). The antibiotic meropenem (MEM) strips were of (0.125-8µg/ml). Strips were placed on the medium. The plates were incubated at 37 °C overnight .The inhibition zones were interpreted according to CLSI breakpoint interpretive criteria (CLSI, 2014).

Analysis of Gene Expression by Real-Time RT-PCR

Real-time reverse transcription (RT)-PCR for analyzing theexpression of the ompK35, ompK36 was carried out by extracting RNA from K. pneumoniaeisolates using RNA extraction Kit (DSBIO/China). Concentrations and purity of the extracted isolates was monitored byNanodrope (Thermo Scientific/USA). RNA samples were reverse transcribed into cDNA by usingWizScript RT FDmix (Hexamer) kit (WizBio /Korea), which is a complete system for thesynthesis of cDNA from RNA template. All the reagents necessary for successful cDNA synthesis in an individually aliquot and lyophilized in single-tube. In each tube 5µl of extracted RNA and 15µl of nuclease free water was added to make a final volume of 20µl. The reaction mix were run in thermal cycler to allow the reaction take place. Reaction conditions of the cDNA synthesis is as follows: annealing at 25°C for 10 min, activation of enzyme at 42°C for 30 min and elongation at 85°C at 4 min. Amplifications were performed in triplicate on a SmartCycler using WizPure ™ qPCR Master (SYBR)WizBio/ Korea). The reaction volume was 20µl,of 10 µlSYBER Green, 2.5 µlof cDNA, 0.5 µl of (10 pmol/μl) of upstream and downstream primers (Alpha/Canada) of each target genes and up to 20µl with nuclease free water. Each gene was run in its own reaction conditions. Data were analyzed using theΔCtand ΔΔCt method, in which the rpoB gene was chosen as a referencegene. All primers used and its reaction conditions are listed in Table (1) and Table (2). All the three genes were with the same dissociation curve of 60 - 95 °C for 2-5 sec.

Table (1): Sequences of primers used in gene expression.

Primer Sequence(5’-3’) Product size

rpoB F: AAGGCGAATCCAGCTTGTTCAGC R: TGACGTTGCATGTTCGCACCCATCA

100bp ompK35 F: GCAATATTCTGGCAGTGGTGATC

R: ACCATTTTTCCATAGAAGTCCAGT

62bp ompK36 F: TTAAAGTACTGTCCCTCCTGG

R: TCAGAGAAGTAGTGCAGACCGTCA

85bp

Table (2): Reaction conditions of each gene used in gene expression.

Gene Step Temperature Time Cycles

rpB

Initial denaturation 95°C 5 min 1

Denaturation 95°C 20 sec 40

Annealing 64°C 25 sec 1

OmpK35

Initial denaturation 95°C 5 min 1

Denaturation 95°C 20 sec 40

Annealing 64°C 30 sec 1

ompK36

Initial denaturation 95°C 5 min 1

Denaturation 95°C 20 sec 40

Annealing 62°C 30 sec 1

Results and discussion

Collection and diagnosis of isolates

A 180 isolates were collected from midstream urine samples, isolates that formed large mucoid colonies on MacConkey and were non-hemolysis on blood agar suspected to beK. pneumoniae, these isolates were negative for Oxidase, Indol, Methyl red and Motility tests, and were positive for Catalase, Citrate utilization, Urease and Voges-poskaur tests, these traditional tests revealed that 48 isolates were K. pneumoniae. Confirmation of the identification of sample were done using VITEK 2 system that including 47 tests, the results revealed that 44 (24.4%) of the isolated bacteria were K. pneumoniae. The molecular identification that were done using K. pneumoniae tyrB also showed 44 (24.4%) isolates were K. pneumoniae.Many studies revealed the same percentage of K. pneumoniaecausing UTI such as in a local study for Al-Zubaidi, (2012) on the Role of plasmids in bacteriocin production from Klebsiella spp. revealed that 22% of bacteria causing UTI was K. pneumoniae, also a study on urinary tract infections and antimicrobial sensitivity among diabetic patients Hamdan et al., (2015) showed nearly similar result, 23%

isolates of K. pneumoniae as causative agent of UTI.

The antibiotic sensitivity test

Antimicrobial susceptibility test was performed for all 44 K. pneumoniae isolates to meropenem antibiotic, using disc diffusion method on Mueller-Hinton agar. Of the 44 isolates, 35(79.5%) isolates were sensitive, 3 (6.8%) isolates showed intermediate resistance and 6 (13.6%) isolates were resistant to meropenem antibiotic. Our findings were higher than a local study conducted by Ibrahim and Hameed, (2015) whom stated that less than 8% of K. pneumoniae isolates were resistant to meropenem antibiotic. In one study by Saad et al., (2014), demonstrated 0% K.

pneumoniae isolates were resistant to meropenem. Another study in Egypt by Barwa and Shaaban, (2017) showed that the resistant rate of K. pneumoniae were 8% of urine samples. In comparison with the results of previous local studies, the current study demonstrated the increasing of antibiotic resistance to meropenem, which is the drug of choice for the treatment of K. pneumoniae infections. The high rates of antibiotic resistance shown in the present study may be due to many factors including recent use of broad-spectrum antibiotics, hospitalization, exposure of patients to a self-prescribed antibiotic because of the availability of medicines without prescription and the transfer of resistance genes by transport means. Meanwhile, our results were in agreement with results of Jarallah and Abbas, (2014), which revealed that 17.6%

K. pneumoniae isolates were resistant to meropenem antibiotic. Also in another study in Egypt by Wassef et al., (2015), it was found that 18.7% of K. pneumoniae clinical isolates were resistant to meropenem. Also the results of one research in Taiwan showed that the resistant rate of K. pneumoniae to meropenem was 16% (Lee et al., 2018).

Results of Minimum inhibitory concentration

MIC for meropenem antibiotic were determined using the (E-test) method, Results of MIC had confirmed the previous results of antibiotic disc diffusion test, where the current study showed that the resistant isolates had high MIC values, while sensitive isolates had lower MIC values to

meropenem antibiotic.The results of the antimicrobial were interpreted according to Clinical and Laboratory Standards Institute (CLSI). Number of isolates that gave MIC values (4-8 μg/ml) were 6 (13.6%) of clinical isolates and 35(79.5%) of clinical isolates were with MIC value of (0.125-0.50 μg/ml). These values ensure resistance of six studied K. pneumoniae isolates for meropenem antibiotic. These findings were concordant with the results of Al-Sultani and Al- Taai (2019) a local study in diyala,Iraq on the Detection of NDM-1 in Cabapenem-Resistant K.

pneumoniae which revealed that the MIC of K. pneumoniae for meropenem reached (8 μg/ml) in resistant isolates. Also in another study in Iran on the Molecular epidemiology of K. pneumoniae in an Iranian hospital by Solgi et al. (2018), had shown an MIC rang of (4-8 μg/ml) in resistant isolates for meropenem.Different MIC values for Meropenem have been reported by several researchers. In a local study in Baghdad by Mohammed (2015), who reported the MIC values for meropenem (≥16 µg/ml). In Malaysia the results of Low et al., (2017) reported a meropenem MIC value (>32 µg/ml).

Expression of ompK53 andompK36 genes

Total RNA was successfully extracted from all the 44 isolates. Concentrations and purity of RNA were measured by Nanodrop spectrophotometer, all of the isolates had concentration between (30- 80 ng/μl) and the RNA purity was (1.6-1.9). RNA samples were reverse transcribed into cDNA, the efficiency of cDNA concentration was assessed through the efficiency of qPCR conducted later. The amplification by quantitative RT-PCR was recorded as a Ct value (cycle threshold). The lower Ct value indicates the presence of higher copies of the target and vice versa. In terms of gene expression, high Ct values indicate low gene expression and low Ct value indicates a high gene expression (Livak and Schmittgen, 2008) (Nolan et al., 2006).In the present experiment, quantitative RT- PCR assay analyzed the mRNA expression of ompK35 and ompK36 genes by comparing the untreated and treated group of samples of resistant bacteria grown with meropenem antibiotic by using (1 μg/mL) of meropenem for each sample and considering the sensitive group of samples as control.Results of mean fold of gene expression in relation with mean MIC value are shown in Figures (1), (2).

Figure (1) Mean fold of gene expression of ompK35 gene in relation with the mean of MIC values depending on ΔΔCt method, (1) sensitive group, (2) resistant group before treatment with

meropenem, (3) resistant group after treatment with meropenem.

1 0.95 0.056

0.32 5.6 5.6

1 2 3

mean fold of gene exepression" mean MIC value

Figure (2) Mean fold of gene expression of ompK36 gene in relation with the mean of MIC values depending on ΔΔCt method, (1) sensitive group, (2) resistant group before treatment with

meropenem, (3) resistant group after treatment with meropenem .

When the mean value of MIC was low (0.32 μg/ml) for the sensitive isolates the mean fold of gene expression ofompK36 gene was high (1.00), and when the MIC mean value was high (5.6 μg/ml) in resistant isolates before treatment with meropenem the mean fold of gene expression was slightly higher (1.32) and the mean fold of the resistant isolates after treating them with meropenem the fold of gene expression was low (0.011). And for ompK35 gene when the mean value of MIC was low (0.32μg/ml) for the sensitive isolates the mean fold of gene expression was high (1.00), and when the MIC mean value was high (5.6 μg/ml) in resistant isolates before treatment with meropenem the mean fold of gene expression wasslightlylower (0.95) and the mean fold of the resistant isolates after treating them with meropenem the fold of gene expression was low (0.056). The fold of gene expression ofompK36 gene in resistant isolates after treatment with meropenem lower than the fold of gene expressionof resistant isolates before treatment with meropenem and this in turn was higher than those in sensitive isolates, and the fold of gene expression of ompK35 gene in resistant isolates after treatment with meropenem was lower than the fold of gene expression of resistant isolates before treatment with meropenem which was slightly lower than those in sensitive isolates. This is important in reflecting the gene copy number present in mRNAs molecules in the samples. It is evident from these results that least copy number of ompK35 and ompK36 genes carried on mRNA in resistant isolates after treatment with meropenem reflecting its lowest expression.The results showed difference in fold of gene expression between K. pneumoniae sensitive, resistant isolates before treatment and resistant isolates after treatment, and it is important evidence that ompK35 and ompK36 gene expression decreases in resistant isolates after treatment with meropenem antibiotic, and this will subsequently contribute in the increase of K. pneumoniae resistance to carbapenems.These results agreed with El Din et al., (2016) their results indicated that there were reduced expression of ompk35and ompK36genes in a significant number of resistant isolates. This study findings were consistent as well as those of Netikul and Kiratisin, (2015), whose results indicated that carbapenem resistant isolates showed various degree of decreased expression of ompk35 and ompK36 genes. Within that respect, Nicolas-Chanoine et al., (2018). Whom studied the interplay between membrane permeability and enzymatic barrier leads to antibiotic resistance in K.

pneumoniae and measured the expression of porin genesompK35 and ompK36 under ertapenem pressure also showed decreased expression in ompK35 and ompK36 genes.

Meanwhile the expression level of rpoB housekeeping gene showed non-significant difference in mean Ct values between study groups, the fold of gene expression of rpoB for the sensitive

1 1.32 0.011

0.32 5.6 5.6

1 2 3

mean fold of gene exepression mean MIC value

isolates, resistant isolates before treatment with meropenem and resistant isolate after treatment with meropenem was (1.00), (0.97) and (1.01), which had led to considering it a reliable housekeeping gene as mentioned in (Gomes et al., 2018) that usedrpoB as normalizer in gene expression in K. pneumoniae.. The calculation of gene expression fold change was made using relative quantification (Livak and Schmittgen, 2008). This depends on normalization of Ct values calculating the ΔCt which is the difference between the mean Ct values of replica of ompK35and ompK36cDNA amplification of each single case and that of the rpoB.To calculate the gene expression folds in relation to the housekeeping gene the result of 2^-ΔCt of each group was measured in relation to that of sensitive group. The 2-^ΔΔCtresults was also applied to calculate the relative gene expression of ompK35 and ompK36 genes. A calibrator was used and it was one of the samples of the controls with high expression of ompK35 and ompK36. All results of gene expression fold depending on both ΔCt and ΔΔCt methods are shown in table (3) and (4).

Table (3): Fold of ompK35 gene expression. Depending on2^-ΔCt and 2^-ΔΔCtMethods

groups

Means Ct of ompK35

gene

Means Ct of rpoB

ΔCt (Means

Ct ofompK35

gene - Means

Ct of rpoB)

2^-ΔCt

Fold of gene expression

Mean ΔCt Calibrator

(ct ompK35 gene -ct

rpoB

ΔΔCt 2-^ΔΔCt

Fold of gene expression

ompK35

B.T. 29.7 22.15 7.55 0.00533 0.95 11.32 -3.77 13.64 0.95

ompK35

A.T. 33.7 22.09 11.61 0.00031 0.055 11.32 0.29 0.81 0.056

ompK35

S. 29.6 22.11 7.49 0.

00556 1.00 11.32 -3.83 14.22 1.00

Table (4): Fold of ompK36 gene expression. Dependingon2^-ΔCt and 2^-ΔΔCtMethods

groups Means Ct of ompK36gene

Means Ct of rpoB

ΔCt (Means

Ct of ompK36

gene - Means

Ct of rpoB)

2-ΔCt

Fold of gene expression

Mean ΔCt Calibrator

(ct ompK36

gene -ct rpoB

ΔΔCt 2^-

ΔΔCt

Fold of gene expression

ompK36

B.T. 27.87 22.15 5.72 0.0189 1.33 11.5 -5.78

54.9 1.32

ompK36

A.T. 34.61 22.09 12.52 0.0001 0.007 11.5

1.02 0.49 0.011

ompK36

S. 28.24 22.11 6.13 0.0142 1.00 11.5 -5.37 41.3 1.00

Conclusions

Present study showed that most local clinical isolates of K. pneumoniae had high percentage resistance to meropenem antibiotics that considered a potent antibiotic of carbapenem used for treatment of UTI caused by K. pneumoniae. The tyrB gene is reliable in molecular identification of K. pneumoniae. The ompK35 gene expression indicated lower fold of gene expression than ompK36 gene in meropenem untreated group, and the ompK36 gene expression indicated lower fold of gene expression than ompK35 gene in meropenem treated group. Gene expression fold was decreased in both porin genes ompK35 and ompK36 in the antibiotic treated resistant group.In antibiotic sensitive group both ompK35 and ompK36 porin genes had slight difference in gene expression fold.The use of rpoB gene gave an ideal results when used as housekeeping gene in the gene expression experiment with the minimal variation in different conditions.

Acknowledgement

We thank Dr. Kais Kassim Ghaima and Dr. Muhanad Kareem for supporting this research.

References

1. Al-Sultani, Z. and Al-Taai, H. (2019). Detection of NDM-1 in Cabapenem-Resistant Klebsiella pneumoniae. Journal of Pharmaceutical Sciences and Research, 11(3), 869- 878.

2. Al-Zubaidi, (2012). Role of plasmids in bacteriocin production from klebsiella spp isolated from clinical samples. Master thesis, Genetic Engineering and Biotechnology for Postgraduate Studies, University of Babhdad: Iraq.

3. Barwa, R. and Shaaban, M. (2017). Molecular Characterization of Klebsiella pneumoniae Clinical Isolates with Elevated Resistance to Carbapenems. The open microbiology journal, 11, 152-159.

4. Clinical and Laboratory Standards Institute (CLSI) (2014). Performance standards for antimicrobial susceptibility testing; Twenty-fourth informational supplement, M100-S24.

Clinical and Laboratory Standards Institute (CLSI), 34(1). Wayne, P.

5. Doménech-Sánchez, A.; Hernández-Allés, S.; Martínez-Martínez, L.; Benedí, V.; and Albertí, S. (1999). Identification and characterization of a new porin gene of Klebsiella pneumoniae: its role in β-lactam antibiotic resistance. Journal of bacteriology, 181(9), 2726-2732.

6. El Din, A.; Hameed Harfoush, R.; Said Oksaha, H.; and Sayed Kohleif, D. (2016). Study of OmpK35 and OmpK36 expression in carbapenem resistant ESBL producing clinical isolates of Klebsiella pneumoniae. Advances in Microbiology, 6, 662-70.

7. Gomes, A.; Stuchi, L.; Siqueira, N.; Henrique, J.; Vicentini, R.; Ribeiro, M.; ... and Ferraz, L. (2018). Selection and validation of reference genes for gene expression studies in Klebsiella pneumoniae using Reverse Transcription Quantitative real-time PCR.

Scientific reports, 8(1), 9001.

8. Hamdan, H.; Kubbara, E.; Adam, A.; Hassan, O.; Suliman, S. and Adam, I. (2015).

Urinary tract infections and antimicrobial sensitivity among diabetic patients at Khartoum, Sudan. Annals of clinical microbiology and antimicrobials, 14(1), 26.

9. Hashemi, A.; Fallah, F.; Erfanimanesh, S.; Hamedani, P.; Alimehr, S.; and Goudarzi, H.

(2014). Detection of β-lactamases and outer membrane porins among Klebsiella pneumoniae strains isolated in Iran. Scientifica, 2014.

10. Ibrahim, I. and Hameed, T. (2015). Isolation, characterization and antimicrobial resistance patterns of lactose-fermenter enterobacteriaceae isolates from clinical and environmental samples. Open Journal of Medical Microbiology, 5(04), 169-176.

11. Jarallah, E. and Abbas, F. (2014). Prevalence of VIM Metallo ß–Lactamase among Clinical Isolates of Klebsiella pneumoniae in Hilla Hospitals. Medical Journal of Babylon, 11(4), 825-835.

12. Jing, Li.; Jianmin, Ma. And Xin, Ge. (2012). Late-Onset Orbital Cellulitis with Abscess Formation Caused by Klebsiella Pneumoniae. Open Journal of Ophthalmology, 2(03), 89-92.

13. Kaczmarek, F.; Dib-Hajj, F.; Shang, W.; and Gootz, T. (2006). High-level carbapenem resistance in a Klebsiella pneumoniae clinical isolate is due to the combination of blaACT-1 β-lactamase production, porin OmpK35/36 insertional inactivation, and down- regulation of the phosphate transport porin PhoE. Antimicrobial agents and chemotherapy, 50(10), 3396-3406.

14. Källman, O.; Motakefi, A.; Wretlind, B.; Kalin, M.; Olsson-Liljequist, B. and Giske, C.

(2008). Cefuroxime non-susceptibility in multidrug-resistant Klebsiella pneumoniae overexpressing ramA and acrA and expressing ompK35 at reduced levels. Journal of antimicrobial chemotherapy, 62(5), 986-990.

15. Kidd, T.; Mills, G.; Sá-Pessoa, J.; Dumigan, A.; Frank, C.; Insua, J.; Ingram, R. et al.

(2017). A Klebsiella pneumoniae antibiotic resistance mechanism that subdues host defences and promotes virulence. EMBO Molecular Medicine, 9(4), 430-447.

16. Kumar, A.; Talwar, A. and Dhatwalia, V. (2010). Antimicrobial Resistance Patterns of Klebsiella spp. Isolated from Raw Milk of Doon Valley. Journal of Biotechnology, (150), 425-426.

17. Lavender, H.; Jagnow, J. and Clegg, S. (2004). Biofilm Formation in Vitro and Virulence in Vivo of Mutants of Klebsiella pneumoniae. American Society for Microbiology, 72(8), 4888–4890.

18. Lee, J.; Huang, Y.; Hsiao, Y.; Lee, C.; Liu, C.; and Chu, C. (2018). Insertion Sequence- Dependent OmpK36 Mutation Associated Ertapenem Resistance in Clinical Klebsiella pneumoniae. Advances in Microbiology, 8(4), 253-269.

19. Livak, K. and Schmittgen, T. (2008). Analyzing real-time PCR data by the comparative CT method. Nature Protocols 3, 1101-1108.

20. Low, Y.; Yap, P.; Jabar, K.; Ponnampalavanar, S.; Karunakaran, R.; Velayuthan, R.; ...

and Teh, C. (2017). The emergence of carbapenem resistant Klebsiella pneumoniae in Malaysia: correlation between microbiological trends with host characteristics and clinical factors. Antimicrobial Resistance & Infection Control, 6(1), 5.

21. Mohammed, A. (2015). Molecular detection of CTX-M genes in Klebsiella pneumoniae isolated from different clinical samples in Baghdad city. Medical Journal of Babylon, 12(1), 152-160.

22. Netikul, T.; and Kiratisin, P. (2015). Genetic characterization of carbapenem-resistant Enterobacteriaceae and the spread of carbapenem-resistant Klebsiella pneumoniae ST340 at a university hospital in Thailand. PloS one, 10(9), e0139116.

23. Nicolas-Chanoine, M.; Mayer, N.; Guyot, K. and Dumont, E. (2018). Interplay between membrane permeability and enzymatic barrier leads to antibiotic-dependent resistance in Klebsiella pneumoniae.Frontiers in microbiology, 9, 1422.

24. Nolan T.; Hands R. and Bustin A. (2006). Quantification of mRNA using real-time RT- PC Nature Protocols, 1 (3), pp. 1559–1582.

25. Saad, N.; Munir, T.; Ansari, M.; Gilani, M.; Latif, M. and Haroon, A. (2014). Phenotypic Identification and Antibiotic Susceptibility Pattern of AmpC beta-Lactamase Producing Escherichia coli and Klebsiella pneumoniae Isolated from Urinary Tract Infections from a Tertiary Care Hospital of Rawalpindi, Pakistan. Journal of Medical Microbiology and Infectious Diseases, 2(4), 143-146.

26. Solgi, H.; Badmasti, F.; Giske, C.; Aghamohammad, S. and Shahcheraghi, F. (2018).

Molecular epidemiology of NDM-1-and OXA-48-producing Klebsiella pneumoniae in an Iranian hospital: clonal dissemination of ST11 and ST893. Journal of Antimicrobial Chemotherapy, 73(6), 1517-1524.

27. Umeh, O.; Berkowitz, L.; Shepp, D.; Talavera, F.; King, J.; Mylonakis, E. and Cunha, B.

(2006). Infectious Disease, Klebsiella Infections. Journal eMedicine. 27 (1).

28. Wassef, M; Abdelhaleim, M; AbdulRahman, E. and Ghaith, D. (2015). The role of OmpK35, OmpK36 porins, and production of β-lactamases on imipenem susceptibility in

Klebsiella pneumoniae clinical isolates, Cairo, Egypt. Microbial Drug Resistance, 21(6), 577-580.

29. Wilson, D. (2014). Ribosome-targeting antibiotics and mechanisms of bacterial resistance. Nature Reviews Microbiology, 12(1), 35.

30. Wiskur, B.; Hunt, J.; and Callegan, M. (2008). Hypermucoviscosity as a virulence factor in experimental Klebsiella pneumoniae endophthalmitis. Investigative ophthalmology &

visual science, 49(11), 4931-4938.

31. Wright, G. (2005). Bacterial resistance to antibiotics: enzymatic degradation and modification. Advanced drug delivery reviews, 57(10), 1451-1470.

32. Zerin, T., Islam, A., Gulnahar, S., Farjana, N. E., Begum, M. A. ., & Sadia, H.-E. (2021).

Identification and Antibiotic Susceptibility of Blood Culture Isolates from Rajshahi, Bangladesh. Journal of Scientific Research in Medical and Biological Sciences, 2(2), 1- 10. https://doi.org/10.47631/jsrmbs.v2i2.264