Molecular Study for Propionibacterium Acnes Isolated from Acne Volcgaris
Researcher Bushra Hussein Alwan Prof. Dr. Dina Mohammed Raouf Al-Qadisiyah University / College of Education / Department of Life Sciences
mailto:[email protected]
Abstract
In this current study, 120 samples were taken from patients with acne of different ages and from both sexes, who were referred to the outpatient clinics in Al-Muthanna Governorate during the period from September to January 2021. It was cultivated on the transplantation environment, to identify the phenotypic and external characteristics, and to conduct chemical tests, Then it was diagnosed by 16srRNA and after conducting chemical and molecular tests, 49 of the 120 isolates were confirmed as Propionibacterium acnes 15 samples were selected from the positive samples for testing of 16srRNA and diagnosed as Propionibacterium acnes, which was tested for the gene responsible for the lipase enzyme (gehA gene), as well as for the gene responsible for the halurundis enzyme (HYL-IB / II gene), as the most important virulence factors in Propionibacterium acnes because the two enzymes played an important role in bacterial pathogenesis, and the result was 100%.
Introduction Acne
Chronic inflammatory or irritating skin disease, which occurs when the hair follicle becomes clogged with sebum and dead skin cells. It is considered one of the most common skin diseases worldwide, affecting the sebaceous capillary units.
(Aslam e tal., 2015) It is considered one of the skin diseases that are most common among adolescents, about 85% of them develop acne, and it affects some young
children less than 10 years old, and adults. For some people, acne usually disappears in their twenties (ALkhfaf, 2005). Acne appears during any time of a person's life, but in most cases it begins in the beginning of adolescence in the thirteenth year when the child begins to physically develop into a teenager, and perhaps one of the most important reasons is the increase in the level of sex hormones during this period, Which leads to the stimulation of the sebaceous glands and the excessive production of sebum (Gollnick, et.al., 2003). There are a group of factors that cause acne, and of all kinds characterized by the occurrence of chronic inflammation around the hair follicles and the sebaceous glands accompanying them. (Dawson & Dellavalle, 2013) Genetics play an important role in acne, as members of the same family develop acne. The main problem with acne is a keratinized plug at the bottom of the hair follicle, the two main important factors in the formation of this plug are the colonization of the follicles by Propionibacterium acnes, , And stimulating the sebaceous glands by androgenic hormones. (Lomhoit & Kilian, 2010). The skin is the largest organ in the body and is the first line of defense to protect the entire body from all pathogens. The skin is the largest organ in the body and is the first line of defense to protect the entire body from all pathogens such as Propionibacterium acnes, Staphylococcus aureus, Staphylococcus epidermidis, Malassezia (Liu, et al., 2018). Propionibacterium acnes is an anaerobic human symbiosis, It is found in the oral cavity, outer ear canal, large intestine and urogenital tract, indicating that the main habitat for its presence is human skin. P. acnes contributes to half of the skin microbes at a density of 106- 102 per cm2 in the skin (Fitz-Gibbon, et al., 2013). There are three types of the genus Propionibacterium (P. avidum, P. granulosum, P. acnes) which are bacilli form multiforme and their cells are usually combined, Slow-growing non-spore-forming. Anaerobic, it also has the ability to produce extracellular enzymes that contribute to disease, such as Lipase, which breaks down
triglycerides into glycerol, and liberates fatty acids, which contribute to the formation of comedone, in addition to other enzymes that lead to rupture of the follicle wall and induce inflammation such as hyaluronidase.
(McDowell, 2018) The lipase enzyme is one of the main virulence factors in P.acnes that are involved in the induced acne (Falcocchio e tal., 2006), one of the extracellular enzymes, and is an important virulence factor in the persistence of bacterial colonization on the skin, stimulating The hydrolysis of the ester bonds within the triglycerides present in the sebum and thus the release of glycerol and free fatty acids, this enzyme is activated by 1mM of Ag, Fe, Ni, Ca, Ba, Mg, NAI, PHMP, SDS, EDTA in addition to 1Mm of lead-activated GehA enzymes (Bek- Thomosen ,. e tal. 2014) gehB was mainly associated with healthy skin with a large number of Propionibacterium acnes presenting it. On the beneficial effect of this enzyme (Dreno, .e tal, 2019).
The production of hyaluronidase by Propionibacterium acnes has been suggested to help the organism spread through the connective tissue.
Hyaluronidase has been classified as a proliferation factor of Propionibacterium acnes due to its ability to attack the hyaluronic acid present in the host tissue (Hynse & Walton, 2000). The enzyme hyaluronidase encoded by the chromosomal gene is the hyl gene. This gene is a gene expression in other bacteria such as S.pneumonae, S.aureus, and S.pyogene which are believed to contribute to the invasion of skin tissue (Kiruthiga., E tal, 2020). The hyl gene is also found in polyporesistant positive bacteria (Louis ,. e tal. 2004).
Materials and Methods
In this study, 120 samples were collected from patients suffering from acne of both sexes during the period from September year to January of the year 2021
where samples were collected from the outpatient clinics in Al-Muthanna Governorate, and the samples included pimples and comedones. The sampling technique is very important, comedone is taken by means of a comedone extraction tool, but the blister is pricked with a sterile prick and the pus is obtained. Then the obtained samples are placed in Transport media and then transported to the laboratory.
Biochemical test
Some important biochemical tests were performed in the diagnosis, such as the urease test, catalase test, oxidase test, and hemolysis.
DNA extraction and purification
Their DNA is directly extracted using a Geneaid DNA extraction kit
Measurement of the purity and concentration of extracted DNA with a Nano drop- spectrophotometer
PCR reactions
Table (1) represents the Propionibacterium acnes 16sRNA gene diagnostic assay
Ingredients Volume in μl
Master Mix 12.5
Forward Primer 1.5
Reverse Primer 1.5
Template DNA 3
Nuclease free water 6.5
Total volume 25
Table (2) represents the optimal conditions for polymerase chain reaction for gene 16srRNA diagnostics
The gene Initiator sequence temperature Time Number of cycles
16srRNA GCGTGAGTGACGGTAATG
GGTA
PA-F 95Ċ 5 min 1cycle
TTCCGACGCGATCAACCA PA-R
95Ċ 45sec 35cycle
60Ċ 45sec
72Ċ 4sec
72Ċ 10min 1cycle
Table (3) represents the optimal combination of gehA gene detection
Ingredients Volume in μl
Master Mix 12.5
Forward Primer 1.5
Reverse Primer 1.5
Template DNA 3
Nuclease free water 6.5
Total volume 25
Table (4) represents the best conditions for detecting the gehA gene The
gene
Initiator sequence temperature Time Number of cycles
geh A TCACTGATGAAGATCAACGCAC PA-F 95Ċ 5 min 1cycle
TGCGAATGTCCGACGAAGTCGA
PA-R
95Ċ 45sec 35cycle
57Ċ 45sec
72Ċ 4sec
72Ċ 10min 1cycle
Table (5) represents the optimal combination for detection of the HYL-IB / II gene
Ingredients Volume in μl
Master Mix 12.5
Forward Primer 1.5
Reverse Primer 1.5
Template DNA 3
Nuclease free water 6.5
Total volume 25
Table (6) represents the optimal conditions for detection of the HYL-IB / II gene
The gene Initiator sequence temperature Time Number of cycles HYL-
IB/II
TTTCGGGATCCTTGTGGTA PA-F 95Ċ 5 min 1cycle
TCTGGACAACAAACCTGT PA-R 95Ċ 45sec 35cycle
54Ċ 45sec
72Ċ 4sec
72Ċ 10min 1cycle
Results and discussion Isolation and diagnosis
The study included collecting 120 samples from acne patients who were subjected to sampling it included taking samples from two forms of acne (comedone and pimple) and from different areas of the body, the face, chest, back and other areas, clinical samples were collected from outpatient clinics in Al- Muthanna governorate during the period September 15, 2020 to January 30, 2021.
From both sexes and the ages of patients ranged between 14 to 38 years, and after conducting chemical and molecular tests, he obtained 49 out of 120 isolates that were confirmed as Propionibacterium acnes.
The results of this study were inconsistent with the results of the study obtained by (Yousif & Dabbage, 2016) which found 25/150 Propionibacterium acnes from isolates from acne patients, the results of this study agree with the results of the study conducted by each Daoudi (2015) who found 52/175.
Results Test
Circular enter convex and white or yellow colonies
Growth on Thioglacollate agar
G+ve Gram stain
_ Oxidase test
+ Lipase product
+ Urease test
+ Maltose fermentation
The most important biochemical test that was conducted
Fifteen of the 16srRNA positive samples were selected and diagnosed as Propionibacterium acnes which was subjected to testing for the gene responsible for the lipase enzyme (gehA gene) because of the importance of the lipase enzyme in the pathogenesis of bacteria as one of the most important virulence factors in Propionibacterium acnes that are involved in the appearance of acne (Falcocchio e tal., 2019), the lipase plays in P. acnes plays an important role in the emergence of acne through the irritating free fatty acids resulting from the activity of lipase in the fatty capillary follicles, where these acids are highly inflammatory and chemical reaction. Lipase is a powerful inflammatory chemical antigen.
Fig. (1-1): Agarose gel electrophoresis of PCR product obtained with P. acnes strains using Lipase -specific primer. lanes 1-15 represent the identified Lipase genes, Lane M represent 100bp DNA ladder
+ Glucose fermentation medium
+ Sucrose production
As well as for screening for the gene responsible for the halurundase enzyme (HYL-IB / II gene, the halurondase enzyme has an important role in promoting the proliferation of Propionibacterium acnes in living tissues and the production of inflammatory cytokines (Nazipi e tal., 2017)) Sugars resulting from HA breakdown and metabolism can be used to provide food Bacteria during their proliferation and reproduction (Marion, et al., 2012), in addition to having HA fractions resulting from HYLS activity, have the ability to interact with host cells to modify the host's immune defenses during bacterial colonization and this depends mainly on the size of the HA fragments resulting from degradation,
Fig. (3-1): Agarose gel electrophoresis of PCR product obtained with P. acnes strains using hyaluronidase gene -specific primer. lanes 1-15 represent the
identified hyaluronidase genes, Lane M represent 100bp DNA ladder.
The result was that all the samples included bacteria belonging to the genus P.
acnes 100 for both genes, and this confirms the importance of these bacteria containing both enzymes. The results of the study are in agreement with the findings of Patel and Tyner (2015) where the HyL-IB / II gene was present in all isolates of Propionibacterium acnes 100%.
Sources
1. _Aslam,I;Fleisecher,A; Feldman ,S(2015).Emerging drugs for the treatment of acne . Expert Opinion on Emerging Drugs.PMID; 20(1):91-101
2. _AL-Khfaf M. R. (2005 ). Isolation and characterization of Propionibacterium acnes from patients with acne Vulgrais. M.Sc. thesis.
Microbiology /Collage of Medicine . University of Babylon –Iraq
3. _Al-Husseiny A . (2005 ) . Bacteriological and Genetical study on Bacteria causing Acne Vulgaris. M.Sc. Thesis. Collage of Science University of Babylon –Iraq.
4. _ Bek-Thomsen M, Lomholt HB , Scavenius C, Enghild JJ , Bruggemann H (2014) . Proteome analysis of human sebaceous follicle infundibula extracted from healthy and acne – affected skin .PLOS One ; 9:e107908 5. _Dreno B .,Pecastaings S .Corvec S ., Veraldi S ., Khammaril A . Roquse C
(2019) . cutibacterium acnes(Propionibacterium acnes) and acne Vulgaris : a brief look at the latest updates., JEADV ; 32(2):5-1
6. _ Dawson , AL ; Dellavalle , RP (2013) . Acne vulgaris . BMJ . 346(5) : 30 - 33
7. -Daoudi M (2015) . Isolation and diagnosis of Propionibacterium acnes from individuals suffer from acne and determination of MIC for common disinfectants against it .M.Sc., thesis. Microbiology /Collage of Science . University of Kirkuk –Iraq
8. _ Falcocchio S , Christian R , F.I, Javier P Luciano S and Pillar D (2006) . Propionibacterium acnes GehA Lipase , an enzyme involved in acne development , can be Successfully inhibition by defined natural substance . Journal of Molecular catalysis B.40:132-137
- Fitz- Gibbon S, Tomida S , Chiu BH e tal (2013) . Propionibacterium acnes strain population in the human skin microbiome associated with acne .J Invest Dermatol ; 133:2152-2160
9. -Hynes ,W.L., and S.L. Walton (2000). Hyaluronidase of gram positive bacteria . FEMS Microbial. Lett. 183:201-207
10. _Lomholt, HB ; Kilian , M (2010 ) . Population Genetic Analysis of Propionibacterium acnes Identifies Clones Associated with acne . PLOS ONE . 5 (8) : e12277
11. _Liu P .F., Yao-D.H., Ya-C.L., Aimee . T., Chih-W.S. and Chun –M. H.
(2018) . Propionibacterium acnes in the Pathogenesis and Immunotherapy of Acne Vulgaris. Current Drug Metabolism ; 16(1):1-10.
12. _ Louis B . e tal (2004). A potential Virulence Gene , hyl Efm, Predominates in Enterococcus faecium of clinical Origin .JID:187(1)
13. _ McDowell A (2018) . Over a Decade of recA and tly Gene sequence Typing of the Bacterium Propionibacterium acnes : What have we learnt ? Microorganism ; 6(1):1-18
14. _ Nazipi S, Stodkilde-Jorgensen K , Scavenius C , Bruggemann H (2017).
The skin bacterium Propionibacterium acnes employs two variants of hyaluronidase lyase with distinct properties. Microorganism ;5:57
15. _ Yousif N.I.M and A. Dabbagh R (2016). Isolation and identification of Microorganism in acne patients , Zanco J . Med . Sci; 20(2):1330-1152
