The significance of matrix metalloproteinase-9 and miR-126 for determination of prognosis of coronary artery disease
Dina Abdelhai
1, Sameh Samir
2, Sara I. El Sharkawy
2, Rasha A. Gaber
3, Ahmed M. Kabel
4,*, Mohamed S. Abd Elghafar
5, Dina A. Ali
11 Clinical Pathology Department, Faculty of Medicine, Tanta University, Tanta 31527, Egypt
2 Cardiovascular Medicine Department, Faculty of Medicine, Tanta University, Tanta 31527, Egypt
3 Medical Biochemistry Department, Faculty of Medicine, Tanta University, Tanta 31527, Egypt
4 Pharmacology Department, Faculty of Medicine, Tanta University, Tanta 31527, Egypt
5 Anesthesia/ICU Department, Faculty of Medicine, Tanta University, Tanta 31527, Egypt
*
[email protected]ABSTRACT
The aim of this study was to evaluate miR-126 and MMP-9 expression in plasma of patients with coronary artery disease (CAD) and to assess their prognostic value.A single blood sample was obtained from 122 CAD patients at admission and 122 healthy controls. Plasma MMP-9 and miR-126 relative expression levels were analyzed byquantitative real-time polymerase chain reaction (qRT-PCR). Also, lipid profile, cardiac troponin I, and creatine kinase-MB (CK-MB) were performed.The expression of miR-126 was significantly decreased and the expression of MMP-9 was significantly increased in CAD patients. Changes in both miR-126 and MMP-9 were significantly associated with major adverse cardiac events.In conclusion, the relationship between miR-126 and MMP-9 in CAD patients might have a significant implication for prognosis of CAD.
Keywords
prognosis; coronary artery disease; miR-126; matrixmetalloproteinase-9
Introduction
Coronary artery disease (CAD) is considered as one of the reasons of sudden cardiac death, accounting for about 80% of sudden cardiac death all over the world. CAD incidence is increasing year by year. So, it may be considered as a major health threat with high morbidity and mortality rates, despite recent advances in medical and interventional therapies [1,2].Soon after myocardial cells injury, some cellular proteins and molecular substances pass to circulation. These substances are now well known and used as clinical indicators, such as cardiac troponin I, creatine kinase-MB (CK-MB) and myoglobin. Cardiac troponin I is the gold standard for myocardial infarction (MI) diagnosis while the other three can also be detected in the non-ischemic patient's blood so they have poor specificity and sensitivity in CAD [3].
Developments of molecular based mechanisms are necessary for early prediction of CAD and recognition of markers for better diagnosis and prognosis [4].miRNAs are important post-transcriptional regulators that modulate the expression of various genes and were proved to have role in the metabolic processes, cell cycle, immune modulation, and stem cell differentiation. miRNAs have been extensively studied as biomarkers and therapeutic targets due to their expression in several diseases [5].
Pathological changes of circulating levels of miRNAs may be useful for prediction and prognosis of many diseases as CAD, heart failure and cancers. With the development of gene detection technologies, the abnormal expression of some miRNAs wasencountered in patients with MI.Many cells express miR-126 as endothelial cells, hematopoietic progenitor cells and plasmacytoid dendritic cells. MiR-126has a role in vascular growth and inflammatory processesof the cardiovascular system [6]. However, relation between miR-126 and CAD occurrenceis still unclear [7].
Matrix metalloproteinases (MMPs) are proteases of great significance especially in the declined stability of carotid plaques. Matrix metalloproteinase-9 (MMP-9) is closely related to ischemic cerebral infarction and has been proven to have a direct relationship with heart failure and MI [8].This work aimed to evaluate miR-126 and MMP-9 expression in plasma of CAD patients and to assess their prognostic value in predicting outcome by short term follow up. The novel point in the present study is that miR-126 and MMP-9 are not only used as diagnostic tools for CAD but also might be evaluated as non- invasive prognostic markers and predictors of CAD outcome.
19533
Subjects and methods
Ethical considerations
Informed written consents were taken from all the participants before being involved in this study. This study was approved by the Local Ethics Committee of Tanta Faculty of Medicine, Tanta, Egypt. The investigations were executed according to the rules of the Declaration of Helsinki of 1975, that were revised in 2013.
Study design, setting, and date
This case control study was carried out atthe departments ofcardiology and clinical pathology, Tanta University Hospital, Egypt from June 2020 to December 2020. It included 122 patients diagnosed as CAD and 122matched healthy subjects as control. Blood samples from CAD patients were obtained at the time of their admission prior to undergoing elective cardiac catheterization followed by short term follow up (30 days).
Eligibility criteria
CAD diagnosis depended on history taking, meticulousclinical examination, resting electrocardiography and echocardiography, and confirmed by coronary angiography performed by 2 cardiologists who also defined the severity of coronary artery lesion. CAD was referred to as stenosis of more than 70% in at least one of the major coronary arteries.
Patients Syntax score whichis an angiographic grading tool to assess the complexity of CAD was calculated according to the baseline diagnostic angiogram. Controls had normal resting ECG and no previous history of cardiovascular insults.
Patients who met the diagnostic criteria CAD, referring to the criteria formulated by European Society of Cardiology (ESC) and patients older than 18 years old were involved in the current study [9]. Patients with incomplete clinical data,marked malnutrition, tumors, mental disorders or cerebrovascular diseases who could not cooperate, patients who had taken glucocorticoids or immunosuppressants recently, patients complicated with impairment of major organs, andpatients with congenitaland valvular heart diseases were excluded from this study.
Methods
Laboratory investigations
Blood samples were taken from all included subjects as follows:Venous blood samples (8 ml) were collected, 4 mL was divided onto 2 EDTA containing tubes, and the remaining 4 ml were centrifuged at 1500×g for 10 minutes for sera separation. Samples were separated and stored at -80°C till the time of analysis.
Total cholesterol, triglycerides, high density lipoproteins (HDL), and CK-MB were analyzed by kits obtained from BioSystems, Barcelona, Spain (Code # 11505, 11528, 11523 and 11792 respectively) according to the supplier’s protocol.Low density lipoproteins (LDL-cholesterol) were calculated by Friedewald Formula [10].Quantitative measurement of cardiac troponin I in serum was calculated by sandwich ELISA human cardiac troponin I kit (CAT # ab200016) supplied by Abcam, USA following the vendor’s instructions.
Assessment of serum miR-126 relative expression level
Extraction of miR-126 was performed by Qiagen® miRNeasy Serum/Plasma Kit (CAT # 217204) following the manufacturer’s instructions. RNA was reverse-transcribed into cDNA using the TaqMan® MicroRNA RT Kit (Applied Biosystems, USA, Part No. 4366596) according to the vendor’s protocol.This was followed by real-time PCR for assessment of miR126 expression as well as the reference gene U6B small nuclear RNA(RNU6B) using the TaqMan®
Universal Master Mix II kit (CAT # 4440043). The reaction was performed in duplicate onStepOne real-time PCR system (Applied Biosystems, USA).
Assessment of serum MMP-9 relative expression level
MMP-9 was isolated by utilisingQIAamp RNA extraction blood Mini kit (QIAGEN, Texas, USA,CAT # 52304) QIAGEN, Hilden, Germanyfollowing the supplier’s instructions. RNA was reverse-transcribed into cDNAusing TaqMan microRNA Reverse Transcription Kit (ThermoFisher Scientific, USA,CAT # 4366596) according to the vendor’s guide.
After that, cDNAs were subjected to RT-PCR amplification on step oneR Real–Time PCR System (Applied Biosystems, USA) using QuantiTect SYBR Green PCR Master Mix kit (QIAGEN, Texas, USA, CAT # 204141) real-time PCR for the detection of MMP-9 as well as the reference gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Primers used were designed and their sequences were as follow: for miR-126F: 5′-TGACAGCACATTATTACTTTTGGTACGCG -3′ R:
5′-TGACCACGCATTATTACTCACGGTAC -3′, for MMP-9F: 5′-CGTGAACATCTTCGACGCCAT -3′R: 5′- TCCTCAAAGACCGACTCCAGC -3′,RNU6BF: 5′-GCT TCG GCA GCA CAT ATA CTA AAA T -3′R: 5′-CGC TTC
ACG AAT TTG CGT GTCAT -3′,GAPDHF: 5′-CTCCTCCTGTTCGACAGTCAG-3′,R: 5′- CCCAATACGACCAAATCCGTT-3′.
To determine the relative expression of miR-126 and MMP-9 among the CAD patients and normal samples, the comparative threshold cycle (CT) method (2¯∆ΔCT method) wascarried out normalizing miR-126 and MMP-9 expression to RNU6B and GAPDH expression [11].
Short-term follow-up and study endpoint
The development of major adverse cardiac event (MACE), that includes death, revascularization, nonfatal myocardial infarction, stent thrombosis, cardiogenic shock, bleeding,stroke, heart failure and septic shock, was assessed at the 30-day follow-up.
The study endpoint was either completion of 30-day post- discharge or mortality or readmission due to MACE.Follow-up was achieved by at least one of the following methods: patient attendance to hospital, hospital records, telephone call to either patient’s general physician or to the patient himself.
Statistical analysis
Data were fed to the computer and analyzed using IBM SPSS software package version 20.0. (Armonk, NY: IBM Corp). Kolmogorov- Smirnov test was used to verify the normality of distribution of variables; Comparisons between groups for categorical variables were assessed using Chi-square test. Student t-test was used to compare two groups for normally distributed quantitative variables while Mann Whitney test was used to compare between two groups for not normally distributed quantitative variables. Kruskal Wallis test was used to compare different groups for abnormally distributed quantitative variables and followed by Post Hoc test (Dunn's for multiple comparisons test) for pairwise comparison. Kaplan-Meier Survival curve was used, and cox regression was performed for the significant relation with progression free survival. Spearman coefficient was utilizedfor correlation between the quantitative variables. Significance of the results was detected at the 5% level.
Results
This case control study was conducted on 122 CAD patients (68 males and 54 females) with mean age 55.0 ± 5.8 years. Also,122 healthy subjects were included as control group (71 males and 51females) with mean age 54.4 ± 5.6years as shown in Table 1.The baseline demographic and laboratory characteristics are given in Table 2.There was no statistically significant difference between patients and controls in age and gender, (P>0.05). There were significant differences between patients and control in triglycerides, total cholesterol, low-density lipoprotein, high-density lipoprotein, CK-MB and troponin I(P<0.05) as shown in Table 1.
Table 1. Comparison between the demographic data and the biochemical parameters in the studied groups Patients
(n = 122)
Control (n = 122)
Test of significanc
e
p-value Age (years)
Mean ± SD 55.0 ± 5.8 54.4 ± 5.6
t=0.823 0.411 Median (Min. – Max.) 55.0 (45.0 – 65.0) 55.0 (45.0 – 65.0)
Gender
Male 68(55.7%) 71(58.2%)
2=0.150 0.698
Female 54(44.3%) 51(41.8%)
Total cholesterol
Mean ± SD 156.8 ± 3.2 150.1 ± 2.1
t=19.401* <0.001* Median (Min. – Max.) 157.0 (150.0 – 163.0) 150.0 (147.0 – 153.0)
TG
Mean ± SD 154.6 ± 10.5 139.7 ± 2.0
t=15.431* <0.001* Median (Min. – Max.) 154.0 (138.0 – 175.0) 140.0 (137.0 – 143.0)
HDL
Mean ± SD 40.1 ± 2.8 43.8 ± 2.1
t=11.604* <0.001* Median (Min. – Max.) 40.0 (34.0 – 46.0) 44.0 (41.0 – 47.0)
LDL
Mean ± SD. 93.4 ± 2.9 83.4 ± 2.1 t=30.885* <0.001*
19535
Median (Min. – Max.) 93.0 (88.0 – 100.0) 83.0 (80.0 – 86.0) Score
Mean ± SD. 26.0 ± 4.7 – – –
Median (Min. – Max.) 26.0 (16.0 – 36.0) –
Troponin I
Mean ± SD. 2.3 ± 4.2 0.2 ± 0.5
U=2820.0* <0.001* Median (Min. – Max.) 0.5 (0.1 – 23.4) 0.2 (0.1 – 6.1)
CK-MB
Mean ± SD. 104.5 ± 208.3 1.2 ± 0.6
U=3657.5* <0.001* Median (Min. – Max.) 2.1 (0.4 – 692.0) 1.2 (0.4 – 2.4)
Outcome
Good outcome (Alive) 109(89.3%) –
– –
Bad outcome –
MACE 9(7.4%) –
Dead 4(3.3%) –
Time follow up (days)
Mean ± SD. 27.7 ± 7.2 – – –
Median (Min. – Max.) 30(1 – 30) –
2: Chi square test; U: Mann Whitney test; *: Statistically significant at p ≤ 0.05
The relative expression level of miR-126 was significantly lower in patients (median value 0.3) compared with controls (median value 0.4) (P<0.001) while the relative expression level of MMP-9 in patients (median value 3.1) was significantly higher than that in the controls (median value 2.3) (P<0.001) (Figure 1A and B).
Figure 1. Comparison between the studied groups regarding to (A) miR-126 and (B) MMP-9 expression
According to the severity of cardiac stenosis, CAD patients were divided into 30 cases with chronic CAD (stable angina pectoris (SAP)) and 92 cases with acute (34 unstable angina pectoris (UAP)), 30 non-ST elevated myocardial infarction (Non-STEMI) and 28 ST elevated myocardial infarction (STEMI)). We observed that relative expression level of miR-126 significantly decrease to reach the lowest value in STEMI cases (P<0.001) while the relative expression level of MMP-9 significantly increase with the severity to reach the highest value in STEMI cases (P 0.019) (Table 2).
Table 2. Relative expression of miR-126 and MMP-9 among CAD patients Relative expression Chronic CAD
(n= 30)
unstable angina UAP
(n= 34)
Non-STEMI (n= 30)
STEMI
(n= 28) H p-value
MMP9
Mean ± SD. 2.8 ± 0.4 3 ± 0.5 3.1 ± 0.5 3.3 ± 0.6
9.900 0.019* Median (Min. – Max.) 2.8(2.3 – 3.7) 3.1(2.2 – 3.7) 3.1(2.3 – 3.8) 3.5(2.2 – 4)
MiR-126
Mean ± SD. 0.4 ± 0 0.3 ± 0 0.3 ± 0 0.2 ± 0
76.425 <0.001* Median (Min. – Max.) 0.4 (0.3 – 0.4) 0.3 (0.3 – 0.4) 0.3 (0.3 – 0.4) 0.3 (0.2 – 0.4)
H: H for Kruskal Wallis test; *: Statistically significant at p ≤ 0.05
During 30 days follow up, 109 patients had good outcome and 13 patients developed poor outcome in the form of MACE. Comparing patients with good and poor outcome regarding their relative expression of miR-126 and MMP-9, we noticed that miR-126 levels at admission were significantly lower in patients who developed MACE than patients with good outcome (median value 0.2 vs. 0.3 P<0.001) while MMP-9 levels at admission were significantly higher in patients who developed MACE than patients with good outcome (median value 3.8 vs. 3.0, P<0.001) (Table3).Our results showed significant correlation between expression level of miR-126 and MPP-9 in CAD patients as shown in Figure 2.
Table 3. Relation between good outcome and bad outcome according to relative expression in the patients’ group (n
= 122) Relative expression Good outcome
(n= 109)
Bad outcome
(n= 13) U p-value
MMP9
Mean ± SD. 3 ± 0.5 3.6 ± 0.6
235.0 <0.001* Median (Min. – Max.) 3(2.2 – 4) 3.8(2.2 – 4)
MiR-126
Mean ± SD. 0.3 ± 0.1 0.2 ± 0.1
237.50 <0.001* Median (Min. – Max.) 0.3 (0.2 – 0.4) 0.2 (0.2 – 0.4)
U: Mann Whitney test; *: Statistically significant at p ≤ 0.05
Figure 2. Correlation between MMP-9 and miR-126 expression in the patients’ group
19537 Based on the median level of miR-126 and MMP-9, CAD patients were grouped into high and low expression groups. The event free survival rate of miR-126 was 96.2% in CAD patients with increased expression and 76.7% in CAD patients with decreased expression while regarding MMP-9 was 82.3% in CAD patients with increased expression and 96.7% in the CAD patients with decreased expression. When we compared event free survival rate between high and low expression groups, we found that low miR-126 expression high MMP-9 expression group was significantly associated with lower DFS survival rate (P = 0.001 for miR- 126 and 0.011 for MMP-9) (Figure 3A and B).
Figure 3. Kaplan-Meier survival curve for event free survival with (A) miR-126 and (B) MMP-9
Discussion
CAD is one of the major health problems all over the world that is precipitated by atherosclerotic lesions which ultimately narrow the lumen of the blood vessels, causing ischemic manifestations, cardiac dysfunction, cellular injury and harmful affection of the cardiac myocytes, fibroblasts and vascular endothelial cells. CAD incidence is increasing year by year.So, there is a crucial need to explorenovel biomarkers for better prognosis and outcome prediction [12, 13].
Over years, many clinical trials reported that miRNA may be used as efficient biomarkers or even effective therapeutic targets for many diseases such as cancers, diabetes and CAD. miRNA in the cardiovascular system was studied and revealed the diagnostic value of miRNA expression for early prediction and prognosis of CAD, MI, heart failure and atrial fibrillation [7]. For example, miR-1, 133, 208 and 499 were up-regulated in CAD patients. Even so, few data are available about the possible relationship betweenmiR-126 expression and CAD [14, 15].
MiR-126 which is one of the non-coding RNA (miRNAs) was proven to inhibit apoptosis and has abnormal expression pattern in patients with tumors [16]. MiR-126 expression was previously studied in diagnosis of CAD and itwas noticed that the changes in miR-126 expression level occur in the same time window as that of myocardial troponin I, but the miR-126 reaches its lowest point earlier [12].
To date,several molecular based mechanismswere used for detection of miRNA and MMPs which are novel biomarkers that may identify CVD risk patients and help in early diagnosis and determination of prognosis of atherosclerosis sequelae and ischemia [2, 8]. Therefore, our study focused on the effect of the expression level of miR-126 and MMP-9 on prognosis and outcome prediction in patients with CAD.
The present study was conducted on 122 patients and 122 healthy subjects matched in age and gender.Our study showed that miR-126 relative expression level was decreased in CAD patients while the MMP-9 relative expression level was increased.Our findings regarding miR-126 were consistent withpreviousreports that miR-126 expression was
significantly declined in CAD patients [17-19].Also,studying miR-126 in the atherosclerotic lesionsrevealed down- regulation of miR-126 expression [20].On the contrary to our findings, it was found that plasma miR-126 was not changed neither by increase nor by decrease in CAD patients [21]. However,He et al. [22] noticed increased expression of miR-126 in populations with acute coronary syndrome.These variant findings may be due to different plaque burden of the diseased vessels in the involved subjects.
Our findings about MMP-9 expression in CAD patients were in consistence with Opstad who found that MMP-9 was significantly increased in CAD patients early before the patients’ blood vessels were opened, but it significantly decreased 3 days to 3 months after the opening [8].Also, a significant relationwas found between MMP-9 level and cardiac biomarkers such as cardiac troponin I and CK-MB,concluding thatMMP-9 may be originated from myocardium after ischemic cardiac insult accordingly it can stimulate MMP-9 release and enhanceMMP-9activity.
In the current study, STEMI patients had the lowest miR-126 expression levels and the highest MMP-9 expression levels among CAD patients.In agreement with our findings, Li et al. [23]found that not only miR-126 over-expression is incriminated in the plaque formation, but also it can predict the extent of the atherosclerotic lesions in patients with CAD.Also, these datawere consistent with Opstad et al. [8] and Khanaghaeiet al. [24] who found that the more severe the coronary artery stenosis was, the lower miR-126 relative expression level and, the higher MMP-9 relative expression level were.
In the current study, we noticed correlation between the levels of expression of both miR- 126 and MMP-9 in CAD patients.Similar results were found by Opstad et al. [8] and Khanaghaeiet al. [24] who detected positive correlation between serum miR-126 and MMP-9 relative expression level as diagnostic markers for CAD.On short term follow up (30 days), we assessed the prognostic value of miR-126 and MMP-9 and we noticed that patients with lower miR-126 expression level and higher MMP-9 expression level had poor outcome and short survival time.Zampetaki et al. [25] proposed that miR-126 is a prognostic marker of incident myocardial infarction. The same results were confirmed by Jansen et al.[26]who reported that miR-126 can predict the occurrence of CVS events in patients with CAD.
Our findings were in agreement with Zhuet al.[27] whorevealed the role ofMMP-9 in early diagnosisas well asprognosis and mortality predictionof CAD patients after percutaneous intervention.Also,Lahdentausta et al.[28]revealed that MMP-9 level predicted death related to cardiovascular insult in CAD patients follow up.
The protective role of miR-126 in CVS may be explained by the finding that it inhibits endothelial cells activation and prevents cardiovascular system damage [16].These damaged cells in turn increase vascular permeability, resulting in low-density lipoproteins deposition on the vascular wall that promotes arteriosclerosis [19, 29].
The interrelation between CAD and increased MMP-9 levels could be explained by short insight into the pathological basis of CAD. Thrombosis is usually generated by atheromatous plaque rupture followed by release of its thrombogenic elements. Thrombosis is followed by MMP-9 release from macrophages and the cells of the smooth muscles.
It had been shown that MMP-9 had strong relation to atheromatous plaque detachment by degradation of its fibrous cap matrix, leading to itsdisruption and gives rise to CAD [30-32].
Conclusion
Plasma miR-126 and MMP-9 levels may represent potential sensitive biomarkers not only for early diagnosis but also for predicting the therapeutic outcomes and prognosis in CAD patients, providing new non-invasive CAD prognostic tool. Further studies involving bigger sample size and multi-center involvement are essential to verify this conclusion and delineate its potential clinical application.
Conflict of interest
The authors had no conflict of interest to declare.
19539
Authors’ contribution
Conceptualization: Dina Abdelhai& Dina Ali; Methodology, Investigation, Formal analysis, and Writing-Original draft preparation: Dina Abdelhai, Sameh Samir, Sara El Sharkawy, Rasha Gaber, Ahmed Kabel, Mohamed Abd Elghafar&
Dina Ali; Writing-Reviewing and Editing: Dina Abdelhai& Dina Ali. All authors had read and agreed to the published version of the manuscript.
References
[1] Bollati V, Angelici L, Rizzo G, Pergoli L, Rota F, Hoxha M, Nordio F, Bonzini M, Tarantini L, Cantone L, Pesatori AC, Apostoli P, Baccarelli AA, Bertazzi PA (2015) Microvesicle-associated microRNA expression is altered upon particulate matter exposure in healthy workers and in A549 cells. J Appl Toxicol 35: 59-67.
[2] Wang HW, Huang TS, Lo HH, Huang PH, Lin CC, Chang SJ, Liao KH, Tsai CH, Chan CH, Tsai CF, Cheng YC, Chiu YL, Tsai TN, Cheng CC, Cheng SM (2014) Deficiency of the microRNA-31-microRNA-720 pathway in the plasma and endothelial progenitor cells from patients with coronary artery disease. Arterioscler Thromb Vasc Biol 34: 857-869.
[3] Sun T, Dong YH, Du W, Shi CY, Wang K, Tariq MA, Wang JX, Li PF (2017) The Role of MicroRNAs in Myocardial Infarction: From Molecular Mechanism to Clinical Application. Int J Mol Sci 18: 745.
[4] Elsheikh N, Sherif N, Zeid SA, Eldamarawy M, Ali A, Sabry AI (2016) The link between bone disease and cardiovascular complications in hemodialysis patients. Electron Physician 8: 2483-2488.
[5] Christopher AF, Kaur RP, Kaur G, Kaur A, Gupta V, Bansal P (2016) MicroRNA therapeutics: Discovering novel targets and developing specific therapy. Perspect Clin Res 7: 68-74.
[6] Harris TA, Yamakuchi M, Ferlito M, Mendell JT, Lowenstein CJ (2008) MicroRNA-126 regulates endothelial expression of vascular cell adhesion molecule 1. Proc Natl Acad Sci U S A 105: 1516-1521.
[7] Viereck J, Thum T (2017) Circulating Noncoding RNAs as Biomarkers of Cardiovascular Disease and Injury. Circ Res120:381-399.
[8]Opstad TB, Seljeflot I, Bøhmer E, Arnesen H, Halvorsen S (2018) MMP-9 and Its Regulators TIMP-1 and EMMPRIN in Patients with Acute ST-Elevation Myocardial Infarction: A NORDISTEMI Substudy. Cardiology 139: 17-24.
[9] Knuuti J, Wijns W, Saraste A, Capodanno D, Barbato E, Funck-Brentano C, Prescott E, Storey RF, Deaton C, Cuisset T, Agewall S, Dickstein K, Edvardsen T, Escaned J, Gersh BJ, Svitil P, Gilard M, Hasdai D, Hatala R, Mahfoud F, Masip J, Muneretto C, Valgimigli M, Achenbach S, Bax JJ; ESC Scientific Document Group (2020) 2019 ESC Guidelines for the diagnosis and management of chronic coronary syndromes. Eur Heart J 41: 407-477.
[10] Friedewald WT, Levy RI, Fredrickson DS(1972) Estimation of the concentration of low-density lipoprotein cholesterol in plasma, without use of the preparative ultracentrifuge. Clin Chem18:499–502.
[11] Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 25:402–408.
[12] Fichtlscherer S, De Rosa S, Fox H, Schwietz T, Fischer A, Liebetrau C, Weber M, Hamm CW, Röxe T, Müller- Ardogan M, Bonauer A, Zeiher AM, Dimmeler S(2010) Circulating microRNAs in patients with coronary artery disease.
Circ Res 107: 677-684.
[13] Kabel AM, Elkhoely AA (2017) Targeting proinflammatory cytokines, oxidative stress, TGF-β1 and STAT-3 by rosuvastatin and ubiquinone to ameliorate trastuzumab cardiotoxicity. Biomed Pharmacother93: 17-26.
[14] Bostjancic E, Zidar N, Stajer D, Glavac D (2010) MicroRNAs miR-1, miR-133a, miR-133b and miR-208 are dysregulated in human myocardial infarction. Cardiology 115: 163-169.
[15] Chen X, Zhang L, Su T, Li H, Huang Q, Wu D, Yang C, Han Z (2015) Kinetics of plasma microRNA-499 expression in acute myocardial infarction. J Thorac Dis 7: 890-896.
[16]Esser JS, Saretzki E, Pankratz F, Engert B, Grundmann S, Bode C, Moser M, Zhou Q (2017) Bone morphogenetic protein 4 regulates microRNAs miR-494 and miR-126-5p in control of endothelial cell function in angiogenesis. Thromb
Haemost 117: 734-749.
[17] Long G, Wang F, Duan Q, Chen F, Yang S, Gong W, Wang Y, Chen C, Wang DW (2012) Human circulating microRNA-1 and microRNA-126 as potential novel indicators for acute myocardial infarction. Int J Biol Sci 8: 811-818.
[18]Ren J, Zhang J, Xu N, Han G, Geng Q, Song J, Li S, Zhao J, Chen H (2013) Signature of circulating microRNAs as potential biomarkers in vulnerable coronary artery disease. PLoS One 8: e80738.
[19] Parizadeh SM, Ferns GA, Ghandehari M, Hassanian SM, Ghayour-Mobarhan M, Parizadeh SMR, Avan A (2018) The diagnostic and prognostic value of circulating microRNAs in coronary artery disease: A novel approach to disease diagnosis of stable CAD and acute coronary syndrome. J Cell Physiol 233: 6418-6424.
[20] Schober A, Nazari-Jahantigh M, Wei Y, Bidzhekov K, Gremse F, Grommes J, Megens RT, Heyll K, Noels H, Hristov M, Wang S, Kiessling F, Olson EN, Weber C (2014) MicroRNA-126-5p promotes endothelial proliferation and limits atherosclerosis by suppressing Dlk1. Nat Med 20: 368-376.
[21] Sun X, Zhang M, Sanagawa A, Mori C, Ito S, Iwaki S, Satoh H, Fujii S (2012) Circulating microRNA-126 in patients with coronary artery disease: correlation with LDL cholesterol. Thromb J 10:16.
[22] He Y, Zhong J, Huang S, Shui X, Kong D, Chen C, Lei W (2017) Elevated circulating miR-126-3p expression in patients with acute myocardial infarction: its diagnostic value. Int J Clin Exp Pathol 10: 11051-11056.
[23] Li HY, Zhao X, Liu YZ, Meng Z, Wang D, Yang F, Shi QW (2016) Plasma MicroRNA-126-5p is Associated with the Complexity and Severity of Coronary Artery Disease in Patients with Stable Angina Pectoris. Cell Physiol Biochem 39:
837-846.
[24]Khanaghaei M, Tourkianvalashani F, Hekmatimoghaddam S, Ghasemi N, Rahaie M, Khorramshahi V, Sheikhpour A, Heydari Z, Pourrajab F (2016) Circulating miR-126 and miR-499 reflect progression of cardiovascular disease; correlations with uric acid and ejection fraction. Heart Int 11: e1-e9.
[25]Zampetaki A, Willeit P, Tilling L, Drozdov I, Prokopi M, Renard JM, Mayr A, Weger S, Schett G, Shah A, Boulanger CM, Willeit J, Chowienczyk PJ, Kiechl S, Mayr M (2012) Prospective study on circulating MicroRNAs and risk of myocardial infarction. J Am Coll Cardiol60:290-299.
[26] Jansen F, Yang X, Proebsting S, Hoelscher M, Przybilla D, Baumann K, Schmitz T, Dolf A, Endl E, Franklin BS, Sinning JM, Vasa-Nicotera M, Nickenig G, Werner N (2014) MicroRNA expression in circulating microvesicles predicts cardiovascular events in patients with coronary artery disease. J Am Heart Assoc 3: e001249.
[27] Zhu JJ, Zhao Q, Qu HJ, Li XM, Chen QJ, Liu F, Chen BD, Yang YN (2017) Usefulness of plasma matrix metalloproteinase-9 levels in prediction of in-hospital mortality in patients who received emergent percutaneous coronary artery intervention following myocardial infarction. Oncotarget 8: 105809-105818.
[28] Lahdentausta L, Leskelä J, Winkelmann A, Tervahartiala T, Sorsa T, Pesonen E, Pussinen PJ (2018) Serum MMP-9 Diagnostics, Prognostics, and Activation in Acute Coronary Syndrome and Its Recurrence. J Cardiovasc Transl Res 11:
210-220.
[29] Dill TL, Naya FJ (2018) A Hearty Dose of Noncoding RNAs: The Imprinted DLK1-DIO3 Locus in Cardiac Development and Disease. J Cardiovasc Dev Dis 5: 37.
[30]Li T, Li X, Feng Y, Dong G, Wang Y, Yang J (2020) The Role of Matrix Metalloproteinase-9 in Atherosclerotic Plaque Instability. Mediators Inflamm 2020: 3872367.
[31] Park HJ, Baek JY, Shin WS, Kim DB, Jang SW, Shin DI, Koh YS, Seo SM, Uhm JS, Kim TH, Kim CJ, Kim PJ, Chang K, Chung WS, Seung KB, Lee JM (2011) Soluble receptor of advanced glycated endproducts is associated with plaque vulnerability in patients with acute myocardial infarction. Circ J 75: 1685-1690.
[32] Wang L, Yang Y, Cui Q, Cui Y, Li Q, Che X, Wang C, Quan P, Hu X (2021) Evaluating the added predictive ability of MMP-9 in serum for Kawasaki disease with coronary artery lesions. J Investig Med 69: 13-19.
